SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05334
Annotation
PREDICTED:_uncharacterized_protein_LOC103314804_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 1.778 PlasmaMembrane   Reliability : 1.922
 

Sequence

CDS
ATGCCGCCTAAATCTAATAAATCCGAGAACGATTTGAAGCTTTTGTACGCTAAGAGGGATATGATTTATTCACGCGTGCAAACAATTTGTGATAATGCACTTAAGATATCCGACTTAGCAATACGAGACTCATTTCTTTGTTCTATTGAAAACATAGACGATTTGCGCGCGGATTTCGAAAGTATCGTTCATAATATCAACGCATTGCAATTAGAACTAGATCCTGATTACGCCGTCAGTTACTCTGTTATGTCGTCGTTTGATGATCTATATTGCCGTATAAAACGTGTCGCTAAATCTTTAGAAAAAATACCTAGCGCCGGGTATTCGCAAACGGAACCTAAGTTCACCCGCGATAGACCTAGATTACCGCCTATCCACATACCCGAATTTAATGGGGACATCCGTAATTGGGGTTTATTTATAGATAGTTTTGAAAATACAGTAAATCAAAATGATCACTTAACCGATCACGAAAAATTACACTACCTAGTAGAAAAACTCACCGGCAAAGCCCGTGCGGCTTGCGCGGGAATTACGTTTAGTGCCGAAAACTATTCATTGATTTTGAACACACTCAAAGCCAAATATGAAGATAAACGGTTGATAGCTACCGCGTACTTGGATCAATTGTTCGAATTAAAACCTATTTTATCGTGTACCGAACAGAATTTGGAGCAATTCTTAGACATATTTGCATCATCTGTTCGGGCTATTAGAAATCTCAACGTCGATGACCTCAGCGACTTTTTATTTTTGTACATTGGCTTAAAAAAGTTAGATTTCGAAACTGTTCGCTTATTTGAAACGAATCAGGGTACTAAGGGTATTGAATTGCCGAAATTTAATGAATTGGAATCATTTTTACGTAATCACATAAGAATACTTCAGCGTACTACGCGACCTCACGAGGTCCCGAAAAGACAACCAGAAAGGCATTTAGAAACGTCCTCAAGACCGCTTAGAACGACTCATAGCTATGTAAATACCGCGGCGTTGCCTGCGTCCGTGCCCGCCAAGTCGACTTGTTTTCTGTGCAAATCTTATCATACACAGTTGTATCAGTGTGCTGGGTTTTTGAAATTGTCGCCTACAAATCGTTATGATTTTGTTCGCACAAATAACTTGTGTTTAAACTGCCTTAGTGATAAACATCGCGTTGGTGTGTGTAATAGTAGCCATAGTTGTCGCAAATGTTCGTTGAAGCATCATACCTTGCTTCATTTTGATAAAAATAGTAATATAGTAGCCAATAGAAATACAAGCGCAGGTAACCAACCAATGTATGGTAACTCGTCGCTAGCAGTATCAAGCTCGGAGCACTCGCATGGTCGAACTCACGCTGGCGGCACCGCACGTTGTACGACACTTCTCGCGCGTCCGGCGTATTCACCCGCGCTTCCCGCCGCTGCTGTCGCTGCCGCTCGCACAGACAGCTCCGCAGCTATCAACTCGGACGGCAACACAAATGACGTCACATTATGCTCGCTGTCTTCCGCTCGCTTACCTACAACTGTTTTGCTTGCGACCGCTCGAGTTGTAATGGTTGATACTTATGGCAAACCGCATCTTGTTCGCGCCCTTTTAGATAGCGCCTCACAGAGTAATTTTATTACTCGTGAATGTTGTCAACGCCTTGGATTAAAATATAGTAACCAGCCTACGTGCCCCGTAGTCAAGGGCATAGGGGGGTCTACTAAGGACATCCAAGGGTCCGTAAAAATTAAATTTGAATCACGTTTTAGCTCGAATGTTTCATTCGAAATAAACTCGCTGGTTGTAGATAAAGTAACGGAGCAACTTCCTACTGTTTCTGTAGATACCTCGTTGTTAGCTAACTTTGATAGTTTGCCGTTAGCCGATGATACTTACGCCGTTCCAGGAGCCGTCGATATTTTGATTGGCGCTTCGATTTTCCCGCACCTCCTGCTGCCACGTAAGGTTCAAGGTCATTCGGCGAACCCCGCACCGCACGCTTTGGAAACTGTTCTCGGTTTTGTTATAGTTGGATCCGCACCCGCTCTTATAAATAGTTACTCGACCGTATCATACTGCTGCGCCGTCGAGCCGCCACTGGACTCCACCGTCCGCCGCTTTTGGGAAATTGAAGAAGTAAATGTTCCGCTGGTTATGAGTCCTGATGATAAGACCGCTGAGGATATTTATTGTAGCACGACCACCCGCGATGAAAGTGGTCGTTATATTGTTGCACTCCCGTTTAAGGGTGATACCTTTTCGCTTGGTGATTCGCGCCTAATGGCCGAAAAACGCTTTTTTTGTTTAGAACGTAAGATGATGGCATCTCCGAAGTTGAAAAAGGCCTACGACGATGTCGTGAATGAATATGTAGATAAGGGTATCATCTCACCTGCTCCCGCTGTACTTGATGAGACGCAAAATGGTCCCTCTTATGTCATCCCGCATCATGGTGTCATTAGGGAGGATAAACTCACCACAAAATTGCGTGTTGTTCTGGATGGCAGTGCTAAGACTAGTACTTCTGTTTCTCTAAACGACATCTTGTATTGTGGTAAAAATCTTCAAGGTAACTTGTTTGATATTATCGTCAATTTTCGTTTATTTATTGTAGCGCTATCTGCAGACATTAGACAAATGTTTCTTTGTATTGGCATTCGGGAATCGGATCGTAGATTCCAAAGATTTTTATATAGGTTTTCCCCACACGAACCATTAAAGGTTTACCAGTTTAACCGCGTTTGTTTCGGACTTAAGTCAAGTCCGTTTCACGCGCTTCGCACTGTGAAGCAGTTAGTTCTTGATGAGGGTGATTCCTACCCCAAGGCAAAAGCTACCATCAATACTGGTCTGTATATGGATGACTTTGCTTATAGTGTAGATAGCGAGCCTGAAGCCATCGAAACAGCTACTCAAGTGATAAGCTTAATGAAGACTGGGCAATTTGACCTTGTTAAGTGGACGAGCAACTCTCAACGTGTTTTGGACTGGATTCCGCCATCGCATCGTCTATCGACGGTTAAGGATTTTGATGTCAATGATACACATAAGATTCTCGGCTTGAGCTGGTCTCCCACATCCGATACATTCAGTCTTAAAATTAGCTCGACCCCGCCAACTTGTACCAAACGCACCATATTGTCTTGTGTCGCTCGCATATGGGACATTATGGGTTTTGTAGCACCTGTAGTGTTATACGCAAAGCTTCTTATTAAAGAGCTTTGGCTTTCTCAGTGTGACTGGGATGACATCGCACCGGACAACGTGGCCAGATTATGGGCTCGCTTTAGGGAAGAGCTTCCTTTGCTCGAACATATAGAAATCCCACGTCATGTAGGTATCTCTCGAGATAGTGTAGTCACAATAGTGGGGTTCGCAGATGCTAGTGAGAAGGCTTATGGAGGAGTGGTGTATTTTCACGTTTGCAATGGCGACAATATTACAGTTAGCCTTATTAGTGCGAAATCTAAAGTCTCCCCTCGAAAGGTCATCTCTCTCGCGCGCCTTGAGCTTTGCGCTCTACTACTATTGACGCGGCTCATTGGTGCCATAGTCAAGGGTTGTAACAACCGCATCAATATTGATAGAATTGCTGGCTTTTCTGATTCAACCGTGGCTTTGTGTTGGGCTCATTCTTCTCCCCACCGTTGGGACACATTTGTTGCTAATAGAGTAGCAAAAATTCAGTCTGAATTATCACCTCAAAATCTATATCACGTCGCTGGAACAGACAATCCTGCCGATTGTCTTTCGCGGGGTTTAACCCCCGCTCAAATATTAGATCATCCGCTCTGGTTTCATGGTCCGTCATGGGTACGAGATGCACCCTGTGATTGGCCAGTTAAGCTTTTTAATCCCGCGACTGTCTCTAAACCGCCAGAAGAAAAACGACACACTCTTGTAACTTCTGCGCCAAGAGAAGACTCAGTTATATTATTGTTGGCTAGTCGTGTTTCGTCATGGTCAAAGTTGTTACGTTGCGTGGTATATGTTTGCCGCTTTGCTAAACTGTTACCACAGCAACAGTACATAGTCGCCTCTGACTTTTATAAGGCAGAGCTTATTGTTCTTCGTGAACTGCAACGAGCGCATTTCGTTTCAGAAATTAATAGCCTAGAGGCTAATAAACCTTGCAGGCGTCCTTTTCAAAATTTGAAGCCTTTCTTACAGGATGGACTCATCCGAGTAGGTGGTCGTTTGAGTCAGTCCAACTTAGGATTTGATCAAAAACACCCCATAGTTTTACCGCGTAAGGGCCACATCCTTGATTTACTGGTCGATTATTATCACAAACTTCACTGTCATGCTGGTCCCGATTTATTGATGTCAATACTTAGACAAAGATATTGGATACTTTCCGCACGTAATTTGATTCGCTCAAGGGTACATAAATGTGTGCCCTGTTATAGACTTCATCCGCGTCCCATCGCACCTGAAATGGCTGACCACCGTTCTTGTCGCGTTGTAGAAACCGCTAAACCTTTCGTGCATACTGGTACAGACTTTGCTGGACCCTTTAAGGTCACCATCTCACGTGGTCGAGGTATTCGTTCATCGAAAGCATACGTTTGTCTTTTCGTGTGTATGACCACTCGTGCTGTTCATATAGAACTAGCCAGTGATTTGAGCACGCATAGTTTCATGGCCGCTTTTAAAAGATTTTTATCACGCCGAGGTCCTGTAGGTTGTATGTACTCAGATAACGGTACAAATTATGTGGGTGCCAAACGCAATATTTCGGAAGTTCACGCTTTCTTGAACTCTAAATACTACAAAACTGAATTCGCACATATGTTAGCAGAAAATCGCATTAAATGGCAGTTTAATACGCCCGCCGCAAGTCACTTCGGCGGAAATTGGGAAGCAAATATAAAAAGCCTTAAATCCCATCTTTATAGAGTTGTAGGGTTGCAGATTCTCACTTTCGAAGAGTTGAGTACCGTGCTCACTCAAATAGAAGCCGTGATGAACACACGTCCGCTATGTAGGACACTGTCTGGCGACCCAGCTGAGCCGTTAGCTTTGACTCCGGCTCACTTTTTGTCGTTGACGCCGCTTAAATATTTACCCGCTAGAGATATTGACGAAGACAGGCAGCATATTCTCTCGCGTCACTCTCTTTTAGATAAATTAGTTCAGTCATTTTGGAAACGTTGGAAAACAGACTACTTACATACGCTACAATCGCGCCAAAAATGGAACACTCCATCCAACCCAATCGTTGTTGGAAAAGTAGTAATTTTAATGACGGAAAACGCGCCCCCGCTACATTGGCCTTTAGGAGTAGTGGAGGAGGTTTTTCCTGGTTCAAATGGAGTGATTAGAACTGTACGCGTTAGGACCGCAACCGGATCGTATCTACGCCCGGTTATTCGCCTCTGCCCTTTACCTAATTCACAATAG
Protein
MPPKSNKSENDLKLLYAKRDMIYSRVQTICDNALKISDLAIRDSFLCSIENIDDLRADFESIVHNINALQLELDPDYAVSYSVMSSFDDLYCRIKRVAKSLEKIPSAGYSQTEPKFTRDRPRLPPIHIPEFNGDIRNWGLFIDSFENTVNQNDHLTDHEKLHYLVEKLTGKARAACAGITFSAENYSLILNTLKAKYEDKRLIATAYLDQLFELKPILSCTEQNLEQFLDIFASSVRAIRNLNVDDLSDFLFLYIGLKKLDFETVRLFETNQGTKGIELPKFNELESFLRNHIRILQRTTRPHEVPKRQPERHLETSSRPLRTTHSYVNTAALPASVPAKSTCFLCKSYHTQLYQCAGFLKLSPTNRYDFVRTNNLCLNCLSDKHRVGVCNSSHSCRKCSLKHHTLLHFDKNSNIVANRNTSAGNQPMYGNSSLAVSSSEHSHGRTHAGGTARCTTLLARPAYSPALPAAAVAAARTDSSAAINSDGNTNDVTLCSLSSARLPTTVLLATARVVMVDTYGKPHLVRALLDSASQSNFITRECCQRLGLKYSNQPTCPVVKGIGGSTKDIQGSVKIKFESRFSSNVSFEINSLVVDKVTEQLPTVSVDTSLLANFDSLPLADDTYAVPGAVDILIGASIFPHLLLPRKVQGHSANPAPHALETVLGFVIVGSAPALINSYSTVSYCCAVEPPLDSTVRRFWEIEEVNVPLVMSPDDKTAEDIYCSTTTRDESGRYIVALPFKGDTFSLGDSRLMAEKRFFCLERKMMASPKLKKAYDDVVNEYVDKGIISPAPAVLDETQNGPSYVIPHHGVIREDKLTTKLRVVLDGSAKTSTSVSLNDILYCGKNLQGNLFDIIVNFRLFIVALSADIRQMFLCIGIRESDRRFQRFLYRFSPHEPLKVYQFNRVCFGLKSSPFHALRTVKQLVLDEGDSYPKAKATINTGLYMDDFAYSVDSEPEAIETATQVISLMKTGQFDLVKWTSNSQRVLDWIPPSHRLSTVKDFDVNDTHKILGLSWSPTSDTFSLKISSTPPTCTKRTILSCVARIWDIMGFVAPVVLYAKLLIKELWLSQCDWDDIAPDNVARLWARFREELPLLEHIEIPRHVGISRDSVVTIVGFADASEKAYGGVVYFHVCNGDNITVSLISAKSKVSPRKVISLARLELCALLLLTRLIGAIVKGCNNRINIDRIAGFSDSTVALCWAHSSPHRWDTFVANRVAKIQSELSPQNLYHVAGTDNPADCLSRGLTPAQILDHPLWFHGPSWVRDAPCDWPVKLFNPATVSKPPEEKRHTLVTSAPREDSVILLLASRVSSWSKLLRCVVYVCRFAKLLPQQQYIVASDFYKAELIVLRELQRAHFVSEINSLEANKPCRRPFQNLKPFLQDGLIRVGGRLSQSNLGFDQKHPIVLPRKGHILDLLVDYYHKLHCHAGPDLLMSILRQRYWILSARNLIRSRVHKCVPCYRLHPRPIAPEMADHRSCRVVETAKPFVHTGTDFAGPFKVTISRGRGIRSSKAYVCLFVCMTTRAVHIELASDLSTHSFMAAFKRFLSRRGPVGCMYSDNGTNYVGAKRNISEVHAFLNSKYYKTEFAHMLAENRIKWQFNTPAASHFGGNWEANIKSLKSHLYRVVGLQILTFEELSTVLTQIEAVMNTRPLCRTLSGDPAEPLALTPAHFLSLTPLKYLPARDIDEDRQHILSRHSLLDKLVQSFWKRWKTDYLHTLQSRQKWNTPSNPIVVGKVVILMTENAPPLHWPLGVVEEVFPGSNGVIRTVRVRTATGSYLRPVIRLCPLPNSQ

Summary

EMBL
GEZM01054789    JAV73399.1    GBBI01004276    JAC14436.1    LBMM01009202    KMQ88311.1    + More
GEZM01085145    GEZM01085143    JAV60187.1    GEBQ01000825    JAT39152.1    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01008464    KMQ88855.1    ABLF02039606    GALX01004947    JAB63519.1    GEBQ01015458    JAT24519.1    GEZM01054765    JAV73413.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    ABLF02008594    ABLF02041614    ABLF02006304    ABLF02036268    LBMM01009863    KMQ87831.1    ABLF02030854    ABLF02067347    GGMR01017890    MBY30509.1    KK114194    KFM61875.1    GDHC01019528    JAP99100.1    LBMM01010417    KMQ87475.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GBBI01004410    JAC14302.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02036131    ABLF02041527    ABLF02064049    GBBI01004408    JAC14304.1    GGMR01002421    MBY15040.1    GGMS01010524    MBY79727.1    NWSH01000070    PCG79985.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GEHC01000869    JAV46776.1    GEHC01000864    JAV46781.1    ABLF02041863    ABLF02023723    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LNIX01000007    OXA51795.1    ABLF02015138    ABLF02035780    LNIX01000069    OXA36894.1    LNIX01000016    OXA46198.1    ABLF02022040    ABLF02056888    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    U23420    AAB03640.1    GEZM01012999    JAV92824.1    LNIX01000002    OXA60848.1    GBBI01004479    JAC14233.1    GBBI01004032    JAC14680.1    ABLF02005684    KQ458473    KPJ05885.1    KQ460500    KPJ14270.1    GGMS01010815    MBY80018.1    GFTR01008866    JAW07560.1    GGMR01002187    MBY14806.1    OXA59522.1    GBBI01004211    JAC14501.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    CR954257    CAJ14165.1    JXUM01113346    KQ565681    KXJ70776.1    GEHC01000870    JAV46775.1    LBMM01009645    KMQ87967.1    LBMM01009964    KMQ87756.1    GDHC01014057    JAQ04572.1    GBBI01004409    JAC14303.1    LBMM01009888    KMQ87813.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GBRD01007977    JAG57844.1    GBBI01004407    JAC14305.1    KQ460970    KPJ10166.1    GGMR01010723    MBY23342.1    LBMM01009551    KMQ88039.1    GGMR01016460    MBY29079.1    GFTR01008874    JAW07552.1    GGMR01013370    MBY25989.1    ABLF02008636    ABLF02065931    GBHO01009080    JAG34524.1    GGMR01010750    MBY23369.1    ABLF02025193    GGMS01014951    MBY84154.1    GGMR01018294    MBY30913.1    GEZM01066272    JAV68024.1    LBMM01009688    KMQ87939.1   
Pfam
PF00078   RVT_1        + More
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
PF09337   zf-H2C2
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1792
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.195640000000001
Exp number, first 60 AAs:
0.0004
Total prob of N-in:
0.00012
outside
1  -  1792
 
 

Population Genetic Test Statistics

Pi
175.868047
Theta
187.80298
Tajima's D
0
CLR
1.617086
CSRT
0.364331783410829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号