SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05333
Pre Gene Modal
BGIBMGA002389
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.285
 

Sequence

CDS
ATGGCTGGAAGTTACATTGTCAACGTGCCTAAATTGAAAGGTCGCGAAAACTTCGACGAGTGGGCGTTTGCAGCTGAACATTTTTTGATGTTGGAAGGTGTCGATATTCATAAGTTAGAATCATCAACCGATGCTAGTTCTATTGATGAAAGAAAAGCTAAAGCTAAACTTATTATGACAATTGACTCTTCAATTTATGTTCACATTAAAAACGAGCAAACAGTACAAGGTGTGTGGAAGCGTTTAAAAGCCCTGTACGATGACTGTGGCTTTACGCGTCGCATCAGTCTACTTCGTCAGCTAATATCAATTCGATTAGAAGATAGCGAATCAATGGAAGCATATGTAACGCAAATGGTCGACACTGCACAAAAACTTAAAGGTACGGGTTTTCAGATCACTGATGAGTGGATCGGTTCACTATTATTAGCGGGCCTAACAGATACATTTGCTCCTATGATAATGGCCATTGAACATTCTGGATTAGCCATCAGTACGGATGCCATCAAGTCAAAATTACTGGACATGAGTTCAGAAGTTGGCAACACTGCAACTAACAATGCCTTTTTGTCGAAAGTAAGTCAGATGATTCGTAATGGAAACAAAGTGAGCTTCGAAGAAGACGTTTGTTACATACGCAATCGACAGAATGTGCTGGTAGGAAAAGCAAACCTGGTGAATGGAGTCTATAAATTGGACATTAAGTCAGACAGTTTGTTCGCGTGCTCAGCCACAACTGTGACTAGTGAGATATGGCATCGAAGATTAGGACACATTAACAGTAGAAGCTTGAATATTATGAAGAATGGTGCTGTGGATGGGATATCATACATGGATAAAGCTGAAATTGATATGTCCAAGTGCATCATATGCTGTGAAGGAAAACAGTCAAGGTTGCCATTTTCACATAAAGGTACGAGAAGTGAAAATGTGCTTGAACTTGTTCATGCAGATGTCTGTGGACCCATGGAACAACCTTCTATTGGACTATCAAAGTATTTTTTGCTTTTTGTAGATGACTACAGTAGAATGGCATTTGTGTTTTTTCTCAAAGCCAAGAACCGAGTTTTCAAATATTTTAAAGAGTTCAAAACTCTGGTTGAGACACAGACAGGCAGAAAACTAAAAGCCTTAAGGACAGATAATGGTGGAGAGTTTTGTTCGCTAGAATTTGATGAGTTTTTGAAGAAAAATGGCATAGTACATCAAACAACAAACCCTCATACACCAGAACAGAATGGCCTGTGTGAAAGACTTAATAGAACTGTCGTGGAGAGAGCTCGGTGTCTTCTGTTTGAAGCAGGCCTAGATAAAAAGTTTTGGGCCGAAGCAATCAACACAGCAGTCTATTTACGAAATAGAACATTGGCAGCAGGACTTAGGAAAACACCTTATGAAATATGGAGTGGTAAAAAGCCAAATCTAAGTCATATACGGATATTTGGTAGTCCTGCAATGGTCCATGTCCCCAAAGCAAAGCGGACTAAATGGAACAAGAAGGCCAATGAACACATCCTGATTGGATACTCAGAGAGTACCAAAGGATACAGGCTGTACAATGTAAAAACAAAAAATATTACCACTAGCAGGGATGTTGTTATCATGGAGAAAATCAACGACACAGATATGATACAAGCAGTAGTGGAAGAAAAAGAAACTATTCCAAGTGAAGAAGGAATACAAAAATGTGCTGTGACAAGTGAAGATTCCACTTGTGACTCACTAAATAGCACATACATGACAGATGATGCTACATATGTACCAGATGATACCAGTACCACCAGCTCAGATGAATTCTGTGATAGTAAATCGAATCACAAGTCAGAAAATCTGCAGCCAATAATTAAGGTGGAAAAGAGGACTAGGAAGAAACCAGACTGGTATGGGTACAATAACATATGTCAGAGCAGTGAGGAGGTGGACGACAATCTTCTCACTTATGAGGATGTAATGAGAGGATCAGAACAAGAAGAATGGTCAAAAGCCATGAAAGAGGAAATACAATCTTTCCATCAGAATGATGCTTGGGAGTTAGTAGACAGACCCAGTGGTGAAAATATTGTGGCATGCAAATGGGTGTATAAAAAGAAACTTAACAGTGACAACTCAGTGAGATATAGGGCACGGTTGGTTGCGAAGGGTTTCAGCCAGAGACAGGGTATAGACTTTAAAGAAACTTTTTCCCCAGTGCTAAAATATTCCACTTTAAAACTGTTATTTGCTATTAGTGTTAACTTGAATCTTAGCATAACCCATTTGGATGTAACGACGGCCTTTTTGAATGGTCACCTAGATGAAACTGTTTTTATGCAATTGCCTCAGAGTTTTGAATGTAAACCTAATGCTGATAAAGTCTTGAAATTGAAAAAGGCCATTTATGGACTAAAACAGTCAGCGAGGGCCTGGCTGTTTAGTTTCTCATGA
Protein
MAGSYIVNVPKLKGRENFDEWAFAAEHFLMLEGVDIHKLESSTDASSIDERKAKAKLIMTIDSSIYVHIKNEQTVQGVWKRLKALYDDCGFTRRISLLRQLISIRLEDSESMEAYVTQMVDTAQKLKGTGFQITDEWIGSLLLAGLTDTFAPMIMAIEHSGLAISTDAIKSKLLDMSSEVGNTATNNAFLSKVSQMIRNGNKVSFEEDVCYIRNRQNVLVGKANLVNGVYKLDIKSDSLFACSATTVTSEIWHRRLGHINSRSLNIMKNGAVDGISYMDKAEIDMSKCIICCEGKQSRLPFSHKGTRSENVLELVHADVCGPMEQPSIGLSKYFLLFVDDYSRMAFVFFLKAKNRVFKYFKEFKTLVETQTGRKLKALRTDNGGEFCSLEFDEFLKKNGIVHQTTNPHTPEQNGLCERLNRTVVERARCLLFEAGLDKKFWAEAINTAVYLRNRTLAAGLRKTPYEIWSGKKPNLSHIRIFGSPAMVHVPKAKRTKWNKKANEHILIGYSESTKGYRLYNVKTKNITTSRDVVIMEKINDTDMIQAVVEEKETIPSEEGIQKCAVTSEDSTCDSLNSTYMTDDATYVPDDTSTTSSDEFCDSKSNHKSENLQPIIKVEKRTRKKPDWYGYNNICQSSEEVDDNLLTYEDVMRGSEQEEWSKAMKEEIQSFHQNDAWELVDRPSGENIVACKWVYKKKLNSDNSVRYRARLVAKGFSQRQGIDFKETFSPVLKYSTLKLLFAISVNLNLSITHLDVTTAFLNGHLDETVFMQLPQSFECKPNADKVLKLKKAIYGLKQSARAWLFSFS

Summary

EMBL
GEZM01011856    JAV93393.1    GEZM01011855    JAV93396.1    GEZM01011859    JAV93384.1    + More
GEZM01011857    JAV93390.1    JYDH01000330    KRY26801.1    GDHC01011760    JAQ06869.1    DNYX01000353    HBK84078.1    GBHO01019781    JAG23823.1    KQ460297    KPJ16236.1    GBXI01011094    JAD03198.1    GAKP01015352    JAC43600.1    KQ459875    KPJ19636.1    LBMM01004924    KMQ91985.1    NWSH01000816    PCG74073.1    NEVH01019375    PNF22597.1    NEVH01006980    PNF36330.1    NEVH01002725    PNF41351.1    NEVH01006721    PNF37230.1    KQ460882    KPJ11482.1    LVZM01021469    OUC41357.1    JYDJ01000808    KRX33413.1    NWSH01002292    PCG68657.1    PCG68658.1    PNF37231.1    JYDJ01000136    KRX42725.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    KL367475    KFD72989.1    KRY26802.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    GBHO01024949    JAG18655.1    GBHO01024951    JAG18653.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    JYDR01000001    KRY80095.1    KL367628    KFD61291.1    JYDU01000001    KRY01876.1    GEZM01045163    GEZM01045162    JAV77888.1    KL367553    KFD64618.1    GEZM01050757    JAV75412.1    CM007901    OTG04806.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    GBXI01017107    JAC97184.1    KA648745    AFP63374.1    CM007899    OTG12557.1    LBMM01008124    KMQ89126.1    CM007900    OTG08534.1    OTG06758.1    GBHO01033237    JAG10367.1    GDHF01030254    JAI22060.1    LSMT01001145    PFX12880.1    GAMC01019995    JAB86560.1    LXQA010002204    MCH81362.1    GDHF01029405    JAI22909.1    GEDG01001927    JAP36462.1    KQ483510    KYP48029.1    KL367515    KFD67411.1    CM007895    OTG22666.1    GFTR01008662    JAW07764.1    AC149291    AAT38758.1    GBXI01002679    JAD11613.1    GAMC01018338    JAB88217.1    GAMC01019998    JAB86557.1    JYDQ01000379    KRY07987.1    GBHO01033235    JAG10369.1    PSQE01000003    RHN67289.1    GDHF01029905    JAI22409.1    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1    GAMC01020736    JAB85819.1    GDHF01000873    JAI51441.1    CM003610    KYP62383.1    CM003608    KYP66219.1    NEVH01021933    PNF19227.1    GAMC01008189    JAB98366.1    GEHC01000963    JAV46682.1    KYP66486.1    OIVN01000313    SPC78143.1    LBMM01012645    KMQ86082.1    OIVN01002473    SPD03944.1    OIVN01006239    SPD28653.1    OIVN01002345    SPD02856.1    AY830138    AAV88069.1    ASHM01014005    PNX95963.1    KQ484186    KYP36645.1    OIVN01004297    SPD16537.1    KYP66220.1    OIVN01000172    SPC75650.1    OIVN01006211    SPD27863.1    JYDL01000068    KRX18751.1    AC133339    DP000009    AAP46257.1    ABF99717.1    CM003606    KYP69041.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF00098   zf-CCHC
PF17766   fn3_6
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036397   RNaseH_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR011009   Kinase-like_dom_sf       
IPR009056   Cyt_c-like_dom       
IPR041469   Subtilisin-like_FN3       
IPR036852   Peptidase_S8/S53_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF56112   SSF56112       
SSF52743   SSF52743       
Gene 3D
PDB
1C1A     E-value=0.000389684,     Score=107

Ontologies

Topology

Length:
807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18756
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00603
outside
1  -  807
 
 

Population Genetic Test Statistics

Pi
250.562055
Theta
132.608803
Tajima's D
-0.957149
CLR
0.55644
CSRT
0.144342782860857
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号