SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05294
Annotation
PREDICTED:_uncharacterized_protein_LOC105842971_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.983
 

Sequence

CDS
ATGCCGCGCATATATAAAGCAGATCCAAGGGGCAAAAGGTATAATAAATATGATGTAAGTCTTATATCCGAAGCAGTAGAAGCATATAGATCTGGCAATAAATCTCTAAAATTCATAGCTGACAAATTTAAAATAGACAAATCAGTATTATATAGGCACGCTACTCGAACTATGAAAAGGCACGGGGGTCAGACTGTCCTGTCGGAGGAGACTGAGGAAACGATAATAAAATATATAAATATATGTGCCGACTGGGGTTATCCATTGGACTCTTTAGACTTGCGATTCCTTGTTAAGTATTATCTTGATAAAGTAGGAAGGACAGTCTTAAAATTTAAAAATAATTTGCCTGGTCCAGACTTTGTAAGAAGCTTCCTTAGGAGGCATAAAGACCAAATATCGCAACGAAACTGTCAAAATATTAAAAATAATAGGGCAGCAGTCTCGCCAATGTCGTTAAAAAAATATTTTGAAGAATTAAAACTGTCTTTAGAAAATGTTGAGCCTCAGAATATAATAAACTATGACGAAACGAATTTAACCGATGACCCTGGCCGGAAAAAAATTATAACAAAACGTGGTACTAAGTACCCAGAAAGGGTAGTCAACCATTCTAAGTCCTCCATATCGATAATGATGTCAGCTACCGCTGAAGGGGATTTGTTGCCACCCTATGTGGTGTACAAGGCCCAAAATTTATACGATACGTGGTGTGAGAATGGGCCAGCGGGAACTAGATATAATCGGTCTCAAAGTGGATGGTTCGACGGCAATATATTCGAAGATTGGGTAAAATCCATTGTTTTGCCTTATTTTAGAAACAAAGAAGGGAAAAAAGTTCTTATTGGGGACAATTTGTCATCACACTTGTCTTTAGACGTAATAAAATTATGTCATGAGCAAGATATATCATTCATCTTTTTACCAGCCAATAGCACACATTTAACCCAGCCATTGGATGTAGCATTCTTTCGTCCAATGAAGATGGCCTGGCGTAACATTCTGGTTAAATGGAAAAAAACAGATGGCAAGTCCCAAACATCTCTGCCCAAAGGATGTTTCCCAAAGCTATTAAAAAAACTCATGGAAGACCTCTCTGAAAATGCCAAACAAAATATAATATCTGGTTTTAGGAAGACCGGAATCAAACCTATTGATCCAAATCAGGTTTTGAGTAGACTGCCGGAAGAACTAGATGTAAAAGAAAGTGGAGAAAATGAAGTTGAAAAATCAGTATTAGACATTCTCAAAGAGATGCGGTATGGAACAACTAATATAAACGAACCAAAAAGAAAAAGAAAATTAGAAGTTATACCAGGAAGGAGTGTTGGTTCTTCTGAAGATTATGGAAAAACTGAGGAAGAATCAGAAAATGTAAAGGAAAAAGCCAAGAGAATCGGCAAAAGGACGAAAAAGATAAATAATGAAGAAAGGATTTATGACGAAGAAACGGCGTATTATGATGAAATGGATAAAAAAGTTTATAAAGGCAAGGGTAAAGGAAAAAAAACAAAACGAAATAAAGGCAAAGAAAATGAAGAAAAAAAGGAAATTGTGTATCAGAAAAAAACAGATGATGCTAACTCTTTAAATAATATACAATATACTGAAATTGATTGTTTATCTAATGAAGATATAGAGGCTATGTCCATTACTATTGGAGATTACGTTTTGTATGAAGGAAATGAAATAGTGATAGCCGAGAATTTTACAAGTACGAGTACAGAAGGTAAAGAGAATTTGACACCGAGAATAAAGAAAATTAGTACAAATAATAAAGTAAACATTCTTGCTGACGAAATTATTTCTCCAAGTACTTCGGACAGAAAGATATCAGTTCATTTAAATGAATGGAGACAAATTTCTCCACATTCTTTTGTTAAAACTGCTAATCAACCTAGCACAAGCGGTTCGAAAAGTACTATGGTGCCTGCACCACGATCATCGTACTACACTAAAGATGCTGATATTCTCAAAGATTTGATGGACGATGATATTATATAG
Protein
MPRIYKADPRGKRYNKYDVSLISEAVEAYRSGNKSLKFIADKFKIDKSVLYRHATRTMKRHGGQTVLSEETEETIIKYINICADWGYPLDSLDLRFLVKYYLDKVGRTVLKFKNNLPGPDFVRSFLRRHKDQISQRNCQNIKNNRAAVSPMSLKKYFEELKLSLENVEPQNIINYDETNLTDDPGRKKIITKRGTKYPERVVNHSKSSISIMMSATAEGDLLPPYVVYKAQNLYDTWCENGPAGTRYNRSQSGWFDGNIFEDWVKSIVLPYFRNKEGKKVLIGDNLSSHLSLDVIKLCHEQDISFIFLPANSTHLTQPLDVAFFRPMKMAWRNILVKWKKTDGKSQTSLPKGCFPKLLKKLMEDLSENAKQNIISGFRKTGIKPIDPNQVLSRLPEELDVKESGENEVEKSVLDILKEMRYGTTNINEPKRKRKLEVIPGRSVGSSEDYGKTEEESENVKEKAKRIGKRTKKINNEERIYDEETAYYDEMDKKVYKGKGKGKKTKRNKGKENEEKKEIVYQKKTDDANSLNNIQYTEIDCLSNEDIEAMSITIGDYVLYEGNEIVIAENFTSTSTEGKENLTPRIKKISTNNKVNILADEIISPSTSDRKISVHLNEWRQISPHSFVKTANQPSTSGSKSTMVPAPRSSYYTKDADILKDLMDDDII

Summary

Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
SUPFAM
SSF46689   SSF46689       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
667
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00137
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00075
outside
1  -  667
 
 

Population Genetic Test Statistics

Pi
40.684751
Theta
61.200885
Tajima's D
-1.092662
CLR
33.849542
CSRT
0.122693865306735
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号