SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05285
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.843
 

Sequence

CDS
ATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATGTTGGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGGGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MGTAGSLSRLLPNVGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    KZ150386    PZC71062.1    + More
KZ149950    PZC76665.1    KZ150308    PZC71477.1    KZ149896    PZC78733.1    AB078935    BAC06462.1    AB078931    BAC06456.1    AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01009501    KMQ88083.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    LBMM01009494    KMQ88097.1    LBMM01008861    KMQ88580.1    D85594    BAA19776.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01014132    KMQ85305.1    LBMM01003679    KMQ93242.1    LBMM01006909    KMQ90209.1    LBMM01006538    KMQ90523.1    ODYU01009945    SOQ54696.1    GL450953    EFN80213.1    QOIP01000009    RLU18544.1    KQ460685    KPJ12887.1    LBMM01004272    KMQ92618.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    QOIP01000010    RLU18098.1    LBMM01008682    KMQ88705.1    QOIP01000031    RLU14697.1    LBMM01006954    KMQ90166.1    LBMM01005634    KMQ91349.1    KQ414641    KOC66782.1    LBMM01024024    KMQ82631.1    LBMM01006657    KMQ90417.1    QOIP01000007    RLU20280.1    LBMM01006671    KMQ90407.1    LBMM01007036    KMQ90099.1    LBMM01008349    KMQ88951.1    LBMM01005216    KMQ91703.1    LBMM01015018    KMQ84954.1    LBMM01005733    KMQ91252.1    GGMR01006442    MBY19061.1    GGMR01016864    MBY29483.1    LBMM01004505    KMQ92346.1    LBMM01011877    KMQ86578.1    LBMM01006110    KMQ90925.1    LBMM01015025    KMQ84953.1    LBMM01007659    KMQ89538.1    RSAL01003504    RVE40273.1    GGMR01012534    MBY25153.1    LBMM01014909    KMQ85000.1    LBMM01006725    KMQ90373.1    LBMM01003245    KMQ93755.1    LBMM01014294    KMQ85237.1    ABLF02041886    GGMR01011974    MBY24593.1    LBMM01012595    KMQ86127.1    LBMM01002480    KMQ94776.1    LBMM01004697    KMQ92167.1    LBMM01004634    KMQ92224.1    GGMR01005740    MBY18359.1    ABLF02023401    ABLF02029423    ABLF02060278    LBMM01020849    KMQ83202.1    LBMM01003988    KMQ92922.1    LBMM01002052    KMQ95336.1    GGMR01015354    MBY27973.1    LBMM01006640    KMQ90440.1    CH963857    KRF98317.1    ABLF02006132    GGMR01019609    MBY32228.1    LBMM01008278    KMQ89009.1    LBMM01006496    KMQ90570.1    LBMM01012412    KMQ86235.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01014956    KMQ84982.1    GGMR01014918    MBY27537.1    LBMM01003941    KMQ92969.1    LBMM01008422    KMQ88894.1    LBMM01007425    KMQ89740.1    GFXV01001748    MBW13553.1    LBMM01005465    KMQ91492.1    LBMM01007162    KMQ89979.1    ABLF02005203    ABLF02041316    GL437417    EFN70484.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
290
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14238
Exp number, first 60 AAs:
0.13345
Total prob of N-in:
0.01512
outside
1  -  290
 
 

Population Genetic Test Statistics

Pi
42.649879
Theta
50.489536
Tajima's D
0.021135
CLR
197.372538
CSRT
0.371531423428829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号