SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05246
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.144 Nuclear   Reliability : 1.361
 

Sequence

CDS
ATGCGAGGAAATGGCCACTTCACAAATGGAGTGGCCATTGTAGTTCCACCCTCCTTAAATAAGTTCGTTCTTGGATATAATCCAGTCTCCGAACGGATTCTCACTATGAAGTTAAACACAAAGCCTTGTATACTCAATATTGTTCAGGTTTATGCCCCAACAAGTACCGCTACCGGATCTGAGATAGAAATTGATCTCCTATACAACAAACTCGACGACGTGTTAGATGCAATTCCAAGTCGGGAGATGATCATGATTCTTGGAGACTGGAATGCTAAAGTGGGCACCACGAAGTTTGACGAACATTTAAGAGAAGTGGTTGGTAGATATGGACTAGGCGTAAGGAACGATCGCGGCGAAAGGTTTATTGACTTCTGCACAAGCAAAAAGCTAACGATAATGAATACTTGCTTTCAACACCATGCTAGACGTCTATACACGTGGGTGTCTCCAGGAGATAGATACAGGAATCAAATTGACTATATCTTAATCAATTCTCGCTGGAGGTCTTCAATAAGCAACGTGAAGACGTTTCCCGGAGCTGACTGTGGTTCTGACCATAATTTGCTTGTAGCTAATTTTGCTTTGCGTTTAAAATCACCAAGAGCACGTACCAAAAGAGTCCCGCAGCTGAGTCCTTCGGAGAGTATTGCATTCCGGCTGTCTCTTGAAGAGAAGTTATCCGACATAATTACTGTCCAATACCCTTCGGCAGACGCCCTTTGGACTAACCTCAAGGAGCTAGTTAATACAACCTTGGATGAAATCCGCAAACCTCAACAACTCGTGCCAAAAAAGTCTGCATGGATTTCAGACCGCACTTGGGCTCTCGCAGAACAGAGAAGGAATCTTAGGGTCAAGGATATGCAGGACCCAGAGGTGAGAGGTGAATACAGTGATCTCTGTAAGTACATTGATGTGTGTTGCAAAGAAGATAAAAACAATTACATTAATGGAATATGTCGTGAGATAGAAAACCACTCCCACAAATACCAAACTGCAGATCTCTTCAAGAAAATCCGCCAGCTTACAAAGAAGTTTAAGCCTAAGTCCTGGGTGATTGAGAATGATGACGGGCGCCTTTTGAATCGGTTAGACGAAATTTCCGAGAGGTGGCGTTCCTATTGTCAGGATCTATACAAAAACCCATCATCTATTACTTCAAGTAATGTACCCGCCATCGATTGTGTGGATAGAGAGCCGAATATTCTTCGAGCTGAGATTGTGGCTGCTTTGCGCTCACTGAAAAATGGGAAAGCACCTGGCCCTGACTTGATATCAGCGGAAATTCTGAAGGTGCTAGGTGATAACGGAATTACTGCTCTGCACTCCATCTGCAACAAAGTGTGGGCGGATGGTGTGTGGCCTAGTGACTGGACTAGGTCGATTATTCTTCCCTTGCACAAAAAAGGCTCAACGAAGCAATGTGATAACTACCGCACGCTTGCACTCATCTCCCACGCCAGCAAGATCTTACTTTACATACTGAACAACCGGATTCGTTACTACCTGGACCAACAGATTCCGCAAGAACAAGCCGGTTTTGTGAAGGGTAGAGGCACGCGTGAGCAAATTCTTAACGTGAGGCAGCTAATCGAGAAGGGTCGCGAATACAATGTTCCATTCATCATGTGTTTCATCGACTACAGCAAGGCTTTTGATTGTGTCAACTGGAGTTCCTTGTGGAAGGTATTGAATGTTCTTGGTGTACCCAATCATCTGATAGTGCTGGTACAGAGCCTGTATATCTACAGTCAGGGAGTTGTCAGAATCGATGAAGCTGTGTCCCAACCGTTCTGTTTTGGAAAAGGTGTCCGGCAGGGTTGCATACTGTCACCTATACTTTTTAATGCATATGGAGAGTACATCATGCGGCAGACTTGTGAAGATTGGTCGGGAGGTGTGCGCATTGGTGGAGCTCATATTACAAATCTCCGATATGCCGATGACACGACCCTGCTAGCTGCAGACGAACCTGAAATGTCTCTTTTCTTCAGCAAAATGGAGCGTATCAGCAACAGCCTAGGCCTCTCCATAAATAGATCAAAAACGAAATTAATGGTGGTGGATCGTGCAAATGTTCTAAGATTGAATGGGGCGCTTGGATTAGAGGTTGTAGACGAATTCGTGTATCTCGGATCCTGCATCAGCAGCAAAGGCTCATGTGAAACTGACGTGCGCCGACGTATCGGAATGGCTAAAAGTGCGATGTCTCAGCTACAGAAGATCTGGAAGAATAGAGGGATAGGCCTGAAAACTAAAACCAGACTGGTGCGGACTCTTGTTTTCTCTATCTTCTTGTATGGAGCTGAGACATGGACGTTGAAAGCAGCAGACCGAATGCGCATCGATGCTTTCGAAATGTGGTGTTGGAGACGCATGCTAAGAATTCCGTGGACAGCCTTCCGGACTAACGTGTCGATATTGAAGCAACTGGGCATCAAAATCAGACTGTCTACTGTATGTCTGAAGCGGATCCTCGAATATTTTGGTCACATTGCGAGGAAAGACGGCGATAACCTGGAAAAACTTATGATCACAGGGAAAGTTGAAGGCAACAGATCTAGAGGCCGCAGCCATACTCGTTGGTCCGATCAGATCCGCACCGCTTTGGACAGTACAGTGTACAGCGCGCTGCATGACGCCGTGGACAGGGGAAAGTGGAAAAAGATCCTAAAATTGAAGCTCATGGGTGATGGTGGTCACGACCCTCAGACATGA
Protein
MRGNGHFTNGVAIVVPPSLNKFVLGYNPVSERILTMKLNTKPCILNIVQVYAPTSTATGSEIEIDLLYNKLDDVLDAIPSREMIMILGDWNAKVGTTKFDEHLREVVGRYGLGVRNDRGERFIDFCTSKKLTIMNTCFQHHARRLYTWVSPGDRYRNQIDYILINSRWRSSISNVKTFPGADCGSDHNLLVANFALRLKSPRARTKRVPQLSPSESIAFRLSLEEKLSDIITVQYPSADALWTNLKELVNTTLDEIRKPQQLVPKKSAWISDRTWALAEQRRNLRVKDMQDPEVRGEYSDLCKYIDVCCKEDKNNYINGICREIENHSHKYQTADLFKKIRQLTKKFKPKSWVIENDDGRLLNRLDEISERWRSYCQDLYKNPSSITSSNVPAIDCVDREPNILRAEIVAALRSLKNGKAPGPDLISAEILKVLGDNGITALHSICNKVWADGVWPSDWTRSIILPLHKKGSTKQCDNYRTLALISHASKILLYILNNRIRYYLDQQIPQEQAGFVKGRGTREQILNVRQLIEKGREYNVPFIMCFIDYSKAFDCVNWSSLWKVLNVLGVPNHLIVLVQSLYIYSQGVVRIDEAVSQPFCFGKGVRQGCILSPILFNAYGEYIMRQTCEDWSGGVRIGGAHITNLRYADDTTLLAADEPEMSLFFSKMERISNSLGLSINRSKTKLMVVDRANVLRLNGALGLEVVDEFVYLGSCISSKGSCETDVRRRIGMAKSAMSQLQKIWKNRGIGLKTKTRLVRTLVFSIFLYGAETWTLKAADRMRIDAFEMWCWRRMLRIPWTAFRTNVSILKQLGIKIRLSTVCLKRILEYFGHIARKDGDNLEKLMITGKVEGNRSRGRSHTRWSDQIRTALDSTVYSALHDAVDRGKWKKILKLKLMGDGGHDPQT

Summary

EMBL
FJ265548    ADI61816.1    FJ265553    ADI61821.1    FJ265557    ADI61825.1    + More
FJ265546    ADI61814.1    GU815090    ADF18553.1    FJ265547    ADI61815.1    FJ265560    ADI61828.1    KZ150025    PZC74827.1    FJ265552    ADI61820.1    FJ265559    ADI61827.1    NCKU01004395    RWS06003.1    NWSH01001998    PCG69477.1    QIAP01000240    PYX61602.1    GU815089    ADF18552.1    GGMR01018096    MBY30715.1    KF881086    AIJ27485.1    NWSH01000469    PCG76200.1    AHAT01017643    AAGJ04118689    AAGJ04161747    NEVH01017534    PNF24114.1    NEVH01015309    PNF27009.1    NEVH01013959    PNF28275.1    NEVH01017570    PNF23798.1    NEVH01002141    PNF42599.1    NEVH01020937    PNF20581.1    NEVH01021219    PNF19787.1    NEVH01012082    PNF31006.1    NEVH01005277    PNF39212.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01002684    PNF41704.1    NEVH01014359    PNF27813.1    NEVH01017460    PNF24248.1    NEVH01003750    PNF40091.1    PNF27789.1    NEVH01019075    PNF22955.1    NEVH01023985    PNF17546.1    NEVH01007402    PNF35815.1    NEVH01014358    PNF27914.1    PDHN01000949    PGH37547.1    NEVH01019064    PNF23230.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01025135    PNF15828.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01019971    PNF22037.1    AHAT01008485    NEVH01013275    PNF29009.1    NEVH01016289    PNF26277.1    NEVH01021921    PNF19488.1    NEVH01013553    PNF28765.1    KF881087    AIJ27486.1    NEVH01016335    NEVH01006721    PNF25462.1    PNF37115.1    PNF37211.1    NEVH01003500    PNF40666.1    PNF37310.1    NEVH01011186    PNF32183.1    NEVH01013215    PNF29703.1    NEVH01020865    PNF20863.1    GFAH01000222    JAV48167.1    NEVH01017443    PNF24485.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
906
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.05086
Exp number, first 60 AAs:
0.77615
Total prob of N-in:
0.03522
outside
1  -  906
 
 

Population Genetic Test Statistics

Pi
290.918883
Theta
19.519467
Tajima's D
2.031186
CLR
0
CSRT
0.887905604719764
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号