SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05213  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002432
Annotation
PREDICTED:_V-type_proton_ATPase_116_kDa_subunit_a_isoform_1_[Papilio_xuthus]
Full name
V-type proton ATPase subunit a      
Location in the cell
PlasmaMembrane   Reliability : 4.581
 

Sequence

CDS
ATGGGGGCTATGTTCCGGAGCGAGGAGATGGCTTTGTGCCAACTCTTCATTCAGCCCGAGGCGGCCTATACCTCCGTCTCAGAGCTTGGTGAAGCTGGCAGCGTGCAGTTCAGAGATTTAAATCCGGACGTAAATGCTTTCCAAAGGAAATTCGTTAACGAGGTGCGCCGTTGCGATGAAATGGAACGCAAACTCCGGTACATCGAGGCTGAGGTGCACAAAGATGGCGTCCACATTCCCGCCGTCAAGGAAGCCCCCCGAGCTCCAAACCCGAGGGAAATCATTGACTTGGAGGCACATTTAGAGAAAACCGAAAACGAAATTCTCGAGCTGTCACACAACGCGGTCAATTTGAAACAAAACTATCTGGAGTTGACCGAATTGAGACATGTCCTTGAAAAGACCGAAGCTTTCTTCACCGCACAGGAGGAAATCGGCATGGATTCTTTGACCAAGTCTTTAATATCTGACGAGACTGGTCAACAAGCGGCCACTCGCGGCCGCCTCGGGTTCGTTGCGGGCGTGGTCCAGCGCGAGCGCGTGCCCGCATTCGAACGGATGCTGTGGCGTATCTCGAGAGGCAACGTCTTCCTACGACGGGCTGAACTGGACAAGCCGCTCGAAGATCCTGCTACGGGTAACGAGATCTACAAGACCGTGTTCGTTGCGTTCTTCCAAGGCGAACAGCTAAAGTCCCGCATCAAGAAAGTGTGCACCGGTTTCCACGCCTCGCTGTACCCGTGCCCGCCTTCGAACACCGAACGACAGGACATGGTCAAGGGAGTCAGGACCAGACTCGAAGACCTTAACATGGTCTTGAACCAAACCCGCGACCACAGACAACGTGTGCTTGCAAGTGTTGCCAAGGAGCTGACCAGCTGGACCATAATGGTGAGGAAGATGAAGGCCATCTACCACACCCTAAATCTGTTCAACATGGATGTCACGAAGAAGTGCCTCATCGGTGAATGCTGGGTACCGACTGCTGATCTACCCAACGTACAAAAGGCACTGGCTGATGGTTCGAACGCATGCGGCAGTTCGATCCCGTCGTTCCTGAACTGCATCGAGACTGACGAGGAGCCGCCCACCTTCAACAGGACCAACAAGTTCACGCGCGGCTTCCAGAACCTCATCGATGCTTACGGAGTCGCCTCTTACCGCGAATGTAACCCGGCTTTGTACACGATCATAACGTTCCCGTTCTTGTTCGCTGTGATGTTCGGCGACCTTGGTCACGGCTGCATCATGGCGATGTTCGGCGGCTGGATGGTCGTGAAGGAAGTCTCGCTCGCCGCCAAGAAATCGAACAACGAAATCTGGAATATATTCTTCGCGGGCCGCTACATAATCCTGCTCATGGGCTGCTTCTCTATGTACACCGGCCTCGTGTACAACGATATCTTCTCCAAGTCTCTGAACATATTTGGCTCCTCTTGGCACATCCCGTACGACAACCACACGCTCGCTGAGAACGGCGCCTTGACGCTCGACCCTAAAGACGCCTACACCGAAGTGCCATACTTCATCGGTATCGACCCTATTTGGCAGAGCGCTGACAACAAGATTATCTTCCTCAACTCGTACAAAATGAAGCTGTCTATCATATTCGGTGTAATCCACATGATATTCGGTGTCTGCATGAGCGTGGTCAACTACAATTTCTTCAAGCGTCGCTACTCCATCTTCCTCGAGTTCCTCCCTCAGATCGTCTTTCTGGCGCTACTGTTCTTGTACATGGTGTTCATGATGTTCTTCAAATGGATCGCGTACAGCACTAAGAATGATGAGCTGGCGTACACCCAAGGCTGCGCTCCGTCGGTGCTGATCCTGTTCATCAACATGATGCTGTTCTCGAAGAACGTCCCGGAGGAGGGCTGCAAGGAGTTCATGTTCGACGCTCAGAGCGACATCCAGCGCGTGTTCGTGTTCATCGCGCTGCTCTGCATCCCCGTCATGCTGCTCGGGAAGCCGCTGTACCTGCTCGCCACTAAGAAGAACAACCCCAAGCCCGAACATTCCAACGGCAGCGTCAACCAAGGCATCGAGCTGCAGGAGCAGACCGACCTCGGCGACGTGCAGCCCAAGCCCGAAGCTAAGTCCAGCGGCGGGCACGACCACGAGGACGAGCCCTTCAGCGAGATCATGATCCACCAGGCCATCCACACCATCGAATACGTACTCAGCACCATCTCTCACACAGCCTCCTACCTCCGACTCTGGGCCTTGTCGCTCGCCCACGCTGAGTTGTCCGAAGTACTATGGAACATGGTGCTGACGTTCGGCTTGAAGGACCATAACTACGTGGGCGCCATCAAGCTGTACGTGGCGTTCTGTTTCTGGGCGCTGTTCACGCTCGCCATCCTCGTCATGATGGAGGGACTCTCCGCATTCTTGCATACTCTGCGTTTGCACTGGGTTGAATTCATGAGCAAATTCTACGCCGGTCTGGGCTACATCTTCCAGCCATTCTGTTTCAAGACGATCCTCGAACAAGAGGAAAATAAAGATGATTAA
Protein
MGAMFRSEEMALCQLFIQPEAAYTSVSELGEAGSVQFRDLNPDVNAFQRKFVNEVRRCDEMERKLRYIEAEVHKDGVHIPAVKEAPRAPNPREIIDLEAHLEKTENEILELSHNAVNLKQNYLELTELRHVLEKTEAFFTAQEEIGMDSLTKSLISDETGQQAATRGRLGFVAGVVQRERVPAFERMLWRISRGNVFLRRAELDKPLEDPATGNEIYKTVFVAFFQGEQLKSRIKKVCTGFHASLYPCPPSNTERQDMVKGVRTRLEDLNMVLNQTRDHRQRVLASVAKELTSWTIMVRKMKAIYHTLNLFNMDVTKKCLIGECWVPTADLPNVQKALADGSNACGSSIPSFLNCIETDEEPPTFNRTNKFTRGFQNLIDAYGVASYRECNPALYTIITFPFLFAVMFGDLGHGCIMAMFGGWMVVKEVSLAAKKSNNEIWNIFFAGRYIILLMGCFSMYTGLVYNDIFSKSLNIFGSSWHIPYDNHTLAENGALTLDPKDAYTEVPYFIGIDPIWQSADNKIIFLNSYKMKLSIIFGVIHMIFGVCMSVVNYNFFKRRYSIFLEFLPQIVFLALLFLYMVFMMFFKWIAYSTKNDELAYTQGCAPSVLILFINMMLFSKNVPEEGCKEFMFDAQSDIQRVFVFIALLCIPVMLLGKPLYLLATKKNNPKPEHSNGSVNQGIELQEQTDLGDVQPKPEAKSSGGHDHEDEPFSEIMIHQAIHTIEYVLSTISHTASYLRLWALSLAHAELSEVLWNMVLTFGLKDHNYVGAIKLYVAFCFWALFTLAILVMMEGLSAFLHTLRLHWVEFMSKFYAGLGYIFQPFCFKTILEQEENKDD

Summary

Description
Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes. Required for assembly and activity of the V-ATPase.
Similarity
Belongs to the V-ATPase 116 kDa subunit family.
EMBL
BABH01010757    BABH01010758    BABH01010759    KQ459220    KPJ02860.1    GDQN01008557    + More
GDQN01001991    JAT82497.1    JAT89063.1    KU550964    ANW09710.1    KQ459984    KPJ18978.1    AGBW02012778    OWR44452.1    GAIX01004080    JAA88480.1    GANO01000631    JAB59240.1    GFDL01009700    JAV25345.1    GFDF01009183    JAV04901.1    GFDF01009184    JAV04900.1    JXUM01123189    JXUM01123190    JXUM01123191    JXUM01123192    GAPW01000216    JAC13382.1    CH478180    EAT33671.1    AAAB01008987    EAA43151.2    APCN01000888    AXCM01006747    AXCN02000267    AJ439060    CAD27758.1    GGFK01001312    MBW34633.1    GGFK01001212    MBW34533.1    GGFJ01002077    MBW51218.1    GGFM01000527    MBW21278.1    GGFM01000600    MBW21351.1    ADMH02001150    ETN63909.1    KA646853    AFP61482.1    CVRI01000006    CRK88011.1    GEBQ01024009    GEBQ01003411    JAT15968.1    JAT36566.1    JXJN01015358    GEBQ01009678    GEBQ01002003    JAT30299.1    JAT37974.1    GDAI01000904    JAI16699.1    UFQS01000635    UFQT01000635    SSX05612.1    SSX25971.1    SSX05611.1    SSX25970.1    GFDG01002067    JAV16732.1    GFDG01002069    JAV16730.1    DS231859    EDS39016.1    CCAG010019856    CH964232    EDW80572.1    GAMC01006625    JAB99930.1    CH916369    EDV93299.1    GDHF01029529    GDHF01021876    JAI22785.1    JAI30438.1    CM000160    EDW95904.1    AF132183    AE014297    AAD34771.1    AAF55552.2    CH902617    EDV42677.1    KPU79847.1    GAKP01016222    JAC42730.1    CH480820    EDW54647.1    GBXI01008638    JAD05654.1    CH479179    EDW24803.1    JR053567    AEY61965.1    CM000070    EAL27684.1    AAZX01007551    CH940652    EDW59356.1    KRF78813.1    KZ288223    PBC31979.1    KQ414710    KOC62988.1    CP012526    ALC46094.1    NEVH01002707    PNF41457.1    CM000364    EDX12446.1    GBYB01003575    JAG73342.1    OUUW01000013    SPP88009.1    KQ971311    EEZ99071.2    KQ977935    KYM98717.1    AJVK01026954    JRES01000835    KNC27927.1    GEZM01101880    GEZM01101878    JAV52238.1    GEZM01101879    JAV52239.1    CH933806    EDW14441.1    KRG01017.1    GFXV01004235    MBW16040.1    KK852470    KDR23260.1    KQ780345    OAD51949.1    KQ976467    KYM84195.1    GL771642    EFZ09639.1    GL446946    EFN87050.1    GDHF01016550    JAI35764.1    ODYU01008382    SOQ51925.1    KQ981905    KYN33595.1    KQ980713    KYN14244.1    KB631625    ERL84786.1    APGK01052546    KB741213    ENN72620.1    KK107589    QOIP01000001    EZA48636.1    RLU27564.1    KQ435724    KOX78327.1    ENN72621.1    ABLF02024323    JRES01000067    KNC34409.1    GDKW01000421    JAI56174.1    JXJN01007702   
Pfam
PF01496   V_ATPase_I
Interpro
IPR026028   V-type_ATPase_116kDa_su_euka        + More
IPR002490   V-ATPase_116kDa_su       
PDB
6O7T     E-value=5.47325e-162,     Score=1468

Ontologies

Topology

Length:
838
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
167.11664
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01083
outside
1  -  403
TMhelix
404  -  426
inside
427  -  438
TMhelix
439  -  461
outside
462  -  533
TMhelix
534  -  556
inside
557  -  560
TMhelix
561  -  583
outside
584  -  597
TMhelix
598  -  620
inside
621  -  640
TMhelix
641  -  663
outside
664  -  767
TMhelix
768  -  790
inside
791  -  838
 
 

Population Genetic Test Statistics

Pi
252.043429
Theta
174.439921
Tajima's D
1.553286
CLR
0.443694
CSRT
0.79726013699315
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 ELTSWTIMVR 100.00 3e-08
28556443 LGFVAGVVQR 100.00 2e-07
28556443 VGIALDDR 100.00 1e-06
28556443 GFQNLIDAYGVASYR 100.00 2e-04
28556443 GFQNLIDAYGVASYR 100.00 2e-04
28556443 DLNPDVNAFQR 100.00 2e-04
28556443 DLNPDVNAFQR 100.00 2e-04
28556443 QNYLELTELR 100.00 7e-04
28556443 AELDKPLEDPATGNEIYK 100.00 7e-04
28556443 TENEILELSHNAVNLK 100.00 0.001
28556443 TENEILELSHNAVNLK 100.00 0.001
28556443 SLISDETGQQAATR 100.00 0.001
28556443 SLISDETGQQAATR 100.00 0.001
28556443 LELTELR 100.00 0.003
28556443 TRLEDLNMVLNQTR 100.00 0.005
28556443 TRLEDLNMVLNQTR 100.00 0.005
28556443 TILEQEENKDD 100.00 0.005
28556443 TILEQEENKDD 100.00 0.005
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号