SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05188
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.479
 

Sequence

CDS
ATGGCCCTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCAGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGTTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGCCCCAGCCCAAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGTGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAATTCCTGCACCGGATCGGAGCCGAACCGACGGCAGAGTGCCTCCATTGTGGTTGCGACTTGGACACGGCAGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATACTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTAGCCCTCTAA
Protein
MALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWFLEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRWLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECLHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAILDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150386    PZC71062.1    + More
LBMM01009501    KMQ88083.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    KZ150308    PZC71477.1    KZ149896    PZC78733.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    LBMM01006538    KMQ90523.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    RSAL01000481    RVE41577.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    ODYU01009945    SOQ54696.1    KQ460685    KPJ12887.1    QOIP01000009    RLU18544.1    LBMM01009494    KMQ88097.1    LBMM01003679    KMQ93242.1    GL450953    EFN80213.1    LBMM01014132    KMQ85305.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    RSAL01003504    RVE40273.1    LBMM01019839    KMQ83438.1    LBMM01008682    KMQ88705.1    LBMM01006110    KMQ90925.1    LBMM01024024    KMQ82631.1    QOIP01000010    RLU18098.1    LBMM01004272    KMQ92618.1    LBMM01006909    KMQ90209.1    LBMM01005634    KMQ91349.1    QOIP01000031    RLU14697.1    QOIP01000007    RLU20280.1    LBMM01014909    KMQ85000.1    KQ414641    KOC66782.1    LBMM01007036    KMQ90099.1    LBMM01006063    KMQ90967.1    GGMR01006442    MBY19061.1    LBMM01006662    KMQ90413.1    GGMR01016864    MBY29483.1    LBMM01002052    KMQ95336.1    LBMM01015018    KMQ84954.1    ODYU01005282    SOQ45985.1    GGMS01002352    MBY71555.1    GGMR01011974    MBY24593.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    LBMM01011877    KMQ86578.1    ABLF02016435    ABLF02016436    ABLF02064751    LBMM01008349    KMQ88951.1    LBMM01006640    KMQ90440.1    LBMM01004505    KMQ92346.1    LBMM01004634    KMQ92224.1    LBMM01015025    KMQ84953.1    ABLF02041886    LBMM01005216    KMQ91703.1    LBMM01003941    KMQ92969.1    ABLF02037241    ABLF02037246    ABLF02044766    ABLF02017307    ABLF02006132    LBMM01002480    KMQ94776.1    LBMM01007425    KMQ89740.1    GGMR01019609    MBY32228.1    ABLF02011238    LBMM01006725    KMQ90373.1    ABLF02023401    ABLF02029423    ABLF02060278    LBMM01003245    KMQ93755.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01012534    MBY25153.1    LBMM01014294    KMQ85237.1    GFXV01002242    MBW14047.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF17919   RT_RNaseH_2
PF00732   GMC_oxred_N
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF51905   SSF51905       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
253
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14965
Exp number, first 60 AAs:
0.14848
Total prob of N-in:
0.01699
outside
1  -  253
 
 

Population Genetic Test Statistics

Pi
134.618365
Theta
94.848382
Tajima's D
1.251058
CLR
0.0028
CSRT
0.725713714314284
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号