SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05151
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.775
 

Sequence

CDS
ATGGCAAGGTGCTTCTCGTGCTGCAACACTGAGGGGGAGCTGCACACGTTCGACGACGCCAGCGAGAGGGCCTACGCGTGTGCAGCCTATTGGCGTCAGAAGACAGACGACAGCACCTACCACGTCACACTACTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCACTGCTGGGGACAAGGATGGCGCAGGCGATAGCGAACGAATTGGACATCGCGGTCGGCAGAAGGACGTACTGGACTGACTCCAGTACAGTTCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCCGGCTCGCAAAACCCAGCAGACGACGCAACTAGGGAGGCACCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGTCGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACCTTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAGGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCTTGCGTGTCCAGACAATCGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCTACATGGAAGTTAAGGACCCCGGAAGCACCTACAGAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAGTACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGGTGCGGCAGCGCTACTGGATCCTAGGTCTAAGATCGATCATTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGACTACCGCCCACCGGAGACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCGATGACGGTGACTGTAGGACGACGTCACGAGAAGAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MARCFSCCNTEGELHTFDDASERAYACAAYWRQKTDDSTYHVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIANELDIAVGRRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLSWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVRLLRATARVLQFIELCRPRKESACVSRQSKQQDPTWRTTRTKQPRSTWKLRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEVRQRYWILGLRSIIRATAVRCQWCKVYRSTPRLPPTGDLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRTSGGLLKRPASKMILLVPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
KQ459986    KPJ18861.1    AAZX01023278    RSAL01000375    RVE42106.1    NWSH01008670    PCG62455.1    LNIX01000003    OXA57597.1    LNIX01000004    OXA56382.1    LNIX01000039    OXA39294.1    LNIX01000019    OXA44812.1    LNIX01000015    OXA46575.1    OXA44855.1    JXUM01013493    KQ560378    KXJ82704.1    GEHC01000914    JAV46731.1    GAMC01020594    JAB85961.1    LNIX01000007    OXA52015.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    JXUM01127084    KQ567147    KXJ69602.1    GAMC01017930    JAB88625.1    JXUM01136032    KQ568367    KXJ69026.1    JXUM01083542    KQ563383    KXJ73941.1    LNIX01000012    OXA48117.1    GEHC01000967    JAV46678.1    GGFL01001842    MBW66020.1    GGFL01001682    MBW65860.1    GEHC01000913    JAV46732.1    JXUM01111221    KQ565482    KXJ70922.1    JTDY01001530    KOB73634.1    AB110069    BAD01589.1    BAD01590.1    GGFL01005193    MBW69371.1    GCES01103975    JAQ82347.1    GCES01110894    JAQ75428.1    JXUM01151198    KQ571164    KXJ68235.1    OXA55241.1    AAGJ04142769    AAGJ04142770    GEBQ01015876    JAT24101.1    GDIP01004568    JAM99147.1    GDIP01036233    JAM67482.1    AAGJ04091218    GEHC01000872    JAV46773.1    AAGJ04001285    GAKP01020709    JAC38243.1    GCES01111900    JAQ74422.1    GCES01134385    JAQ51937.1    MRZV01000348    PIK51982.1    GGFK01006929    MBW40250.1    JXUM01144298    KQ569759    KXJ68523.1    GCES01140631    JAQ45691.1    GCES01132273    JAQ54049.1    AAGJ04146728    AAGJ04146729    KL367508    KFD68106.1    AAGJ04125735    AAGJ04095911    GDIQ01002920    JAN91817.1    LSMT01000016    PFX33015.1    GBYX01150372    JAO92643.1    GCES01097275    JAQ89047.1    HAEJ01014775    SBS55232.1    GDIQ01143107    JAL08619.1    GDIQ01002921    JAN91816.1    GCES01130483    JAQ55839.1    GCES01130050    JAQ56272.1    JXUM01146045    JXUM01146046    GCES01095441    JAQ90881.1    AAGJ04011066    AAGJ04020014    JXUM01109099    KQ565290    KXJ71123.1    AAGJ04008210    GDIQ01114015    JAL37711.1    JXUM01005879    KQ560203    KXJ83865.1    GBYX01472248    GBYX01472237    GBYX01472235    GBYX01472234    JAO09406.1    JAO09417.1    JAO09419.1    JAO09420.1    GCES01096813    JAQ89509.1    GBYX01459357    JAO22202.1    GDRN01111557    JAI56761.1    GDRN01111556    JAI56762.1    KQ460970    KPJ10166.1    OXA55408.1    GCES01112016    JAQ74306.1    GCES01114344    JAQ71978.1    GBYX01459355    JAO22204.1    QCYY01001488    ROT77729.1    GDIQ01071585    JAN23152.1    GDIQ01071584    JAN23153.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000477   RT_dom       
IPR001841   Znf_RING       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       

Ontologies

Topology

Length:
491
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00347000000000001
Exp number, first 60 AAs:
0.00124
Total prob of N-in:
0.00905
outside
1  -  491
 
 

Population Genetic Test Statistics

Pi
425.699012
Theta
220.27077
Tajima's D
2.667333
CLR
80.776148
CSRT
0.958302084895755
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号