SGID The Silkworm Genome Information Database
Gene
KWMTBOMO05134
Pre Gene Modal
BGIBMGA012468
Annotation
PREDICTED:_centrosomal_protein_of_290_kDa-like_[Bombyx_mori]
Full name
Centrosomal protein of 290 kDa      
Alternative Name
Bardet-Biedl syndrome 14 protein homolog
Nephrocystin-6
Location in the cell
Nuclear   Reliability : 3.459
 

Sequence

CDS
ATGAATACAGCCATGCAACTGGAGAATGAGATTGCTATAAAAAATAAACACATTAAAAAGCTTCTAGCTGACGTTAAGGTCTTAGAAGAAGACAATCTTACATTCAAAGGAAAAGTTTCCATTTTGAAAGATAAACTAATCGAAGCTACACAGATTATAGATAATTTGACCGAACAATTACTTTCGATGAAGAATGAGACTGCGCGCTTAAAAGAAATATTGGGAAAATCAGAGCAAATAAAATCGCAACAGTCAGCTGAAATCGAAGTGCTGAAACAAAATTCTGAACGAGATGCTTATTCGCATAAGTGCACTATTCCGGAAGAAATTAAATTAAAAATTAAGCATTGGAAGGATATGGCTCGTTCCAAAAAGATCGAATTAGATATGATAGCTCTCGAAAACGTGAAACTAAAAGAACAACTTTCTAAAACCTATCAGCTACCCCCAACACACGATGAAGGCAGATCTTCTCGTGAATTTGAAATAAAAATAAAAGAGCTACAAGAAAAATTGCATGAAGCTACAAATGAAATCGAACGTTCTGCTATAATAATTAATACACTAAAGGCAGAAATACGTCAATTAAAAAGTGTTATAGAAGAAACACCCGATCCAGTTTCTGAAGTGAGAAATGAAAGTGACGACGGGAAGCAAAGAGCAATCATAAGACGATTGAGGAAAAAAAACATAGATTTAATAGCTTCTCTCCATGGGGCAGATGAGGTTCTTATCGCACGTGAAAAGGAGTTATCAGAAGTTACCGCGCAATTACAGTTAATTCAATCTGAAGAAGGTGTAAGTGTCTTGATCGAAGGATTGAAAAATAAAAAGAATCAGCTTAAAATTAAAGACGAAGGTATCAAAAGTCTAGTTCAAGAGGTTAATACTTTACATCAATTGGTGACTGATCTGCAGTTAGAAAATGAAACTCTAAGACAAAAATATAACATTCCTTTTGATGAAAGAGTTTGTACAAAAGGCATTCTAAAAAAATACCGAGATATGGAGCTACTCAATGCTAAAATGAAAAACGAACTAAAACACGTGGAAAACAAAATAATCGATTTGGAACTAAACGAAAGATGTATGTCTTCAAAAATTATAAAACTAAAAAAAATATTAACTTTGCAAGGGTATAATGTTGATGACGCCTATTTGAACGCTGAAGATGATGAATATAATGAGGAAATTTTAAGTGGTGCAAAAGAATCTTTGGCGATTGATCAATCTATAAATTTAGTACAGCATGTGAAGAGTAGCAATGAAACTGAAAATATACAGGCAATAATCGACGAAAACGAAGGATTAAGAAAAGCACTTCAAGAGCTCTTAGATTTTTTAAAAGACAACAGTTCCACTTCCTCGGGAGTATTGGCGTTACAGTGTCCAAGTCTTGAGTCAATTTTACAAAAAATGGGAATCAGACACGCAGCCGGCTGGTTTTCACCACACATGTCTACTTTTATGGAATTAGAAGCGGCACGTGGAGGAAAAGAAGCATTGCTTTTAGCGCTTCACGAAGCCAGGAAAGAAACATTCAATTTAATGAAGAACTTATCTCATCAATCAAAAATAAATGAAGATCTTCAAAAAAAAGTTAACGAATTAGAGTCTCAGAGTGTACAAAATTTTGATCTCGAAGATAACTTGTTCGAATTTGGTTCATGGGTAACAGAGGAAGAAATCAATTCTGTTGACTTTTATGACAAAGAACAATTACAAGACAGTGTGCATATTAAAAGTCAATTGATGTATGAAAATACATTGAAAAAGGTACTAAAACATTTCCATGATCAGTTTAAAGTTCTATACGACAAAATGAATTCACTAGCCATAGAACATATAGATAAAAACAATCATTGGTTAATTCAAGAAGAACGGTACAAAGCCGAAATTGAAAATTTAAAGATTCGTTTACAGCAAAATGAAGATGAAGACTTTAGTAATGCATCACCTGGTCTTTTACCTACATCGAATACTTCTATGCTTGAAAGAAGATGTTCATATTTAGAAGATTCTTACAAAGACATTAGGAACATAAACGAAAACTTAAGAAATGAAAATATAGAATGTAAAAGAGAAAAAACGTTAGTGGTCTCAGAAAACGAAATTAAAACGCAGAAGCTATTGCTACTTATTTGTGACATTACTGATAAGCTGCGTTCTTCAATAGCCCTTGACTTGTTTTGGGACCAAAACAGACTTCTCAACGAAGTAACATTAAAATATAGAAAAATTGCTGAAAATACTTTTAAAGATAAAAATAAAACCATGGACATGTTAAAGTGTCTTGAAGAAAGTAAATCGGAAATTATTAATTACGTTCAAAAACAACTGTGTGAAAATGTAGGCGATGCCGATAGACGTCAAATACTTAATGAAGTGGAACAATTAGCAATAGAAAAACAATTGCGACAATCAATAACAGAATTAGAAAAGAGAGAAAAAGAAATCAATTTGTTGGAATCCAAATATATGGAACTAAATCAACTGCAAGCAGGCCTTATCGATGATTCTTTACGCTCGGTAAATACAGAAGAAATTAATTTTATGAAATCCCAGATTTCTAATCTTTCTGCGGAACGGAAAATACTCAAAGAACAATATCAATCCACTAAAGATCAATTAGAGGTTACAATATTGCAGTTGCAAGAATTCCAACAGCGTCAAATGTGCAAAGAAATCGAAGTAAATATTCTAAGGCATCAAATACTAGATTTACAATCAACTGGAAATAATAAAGCAGTCGTTGCAAGGCTGAGTAGTGAATTATTAGTGACACATTTACAAGCTTCAGAGTATAATAGAAAAATTCAAGAGTTGACCACAGCTCTGAATAAGGAAAAGGAAATGAGAGCAGATATCGAAGATATTTTGTCTACCAGGCAAAAAGTTTTTGACCTTTATACACGTAGATACGACTCAAAATTCAAACATATTCACACGGTATTGAATATTATGCGGCTCCAATACCAAGGAAGTTTGCCTTTGACGTCAATAGAAAATTTTGTCTCCAAATTGGAAGATCTTTCTCGTAAAAATCATGCAATTAATCAACAACTAACTGAAGTTGACGAGCTGCGGACCAGTTTAGTGACAAAACATGCTGTATTCGATCAAATACTCGACGTTTCTAAAGATAAATGCTTACTTCAAGAAGATGACTGTCCACACAAATTAAAAAGTTTTATTATGGATGCAACGCATGCCCGAGAGATGGATAATATGAAGAAGAAAATTAAAATATCTGAACAAGTACGTGAAGAACTTTTAAGTCAATGTACTAACTTAGAAAAGACTTTGGCATATATTAATCAAGGTTATGAAAAATACACCTCCGTTGAGTTGAAGCACAAGCTGAAGGAAGTACAAAATGATGAAGCCATAAATTTAGAGGATCTGGTATCAGACGAAGAGCCAGATTCCAGAAGTAGTCGAATAGCTAAATCTCAAATACTCAAACCTACAACACATACCAAAGCAACTGTAACTGATATTAATAACGAACACCTTCAAGAAAATTTATTTGGTTCCCCGGCGAAGAAATTACCAGTGACACAACTCAAGCCAAAGGTAGCCAATGTTTTTGTACAAACAGACCAGTTGACACTATGCAAAAGTGAAAAAAACATTCAAACCGAAGAAGACGCTCTCATTATTGACATGAAATATTCTATTGAAAGTGCTAGAAATGATATAAAAATTAAAATGCGAGAACTTGATGAAGCTCTCTTGGTAGCTAAGAAACGTACGGAAGAAATGTTGATAATGGAATCAGAAAAAATAGATATACAATCGAAAATAAAAAATCTTCATCATACAATTAAGGAAAAGGATAATTTGAATAATCAGTTACAAAAAACTTTGTCTGAATTAAGAAAACAAGTAGAAGTTTCTCAGAATTTACAAATTGAAGAAATAGATAAGATTAAGCACTTAGAAAATGAAGAGACTAAAAAACTGTTATCGGCCTTGAAAGAATTAGAAAACGACAAAAATAAAATAATTGAGGAATACAAACAGCTACTGTATAACGAAAGAGAAGAATACACAAAAGCTATGAAGGAATTGCAAGTGAAATTATTTGAATTACAAACCAAGCTAGACAGGTACATACACAAATGGAATAAAGCTTTCTTTGAAGTAGCTTGA
Protein
MNTAMQLENEIAIKNKHIKKLLADVKVLEEDNLTFKGKVSILKDKLIEATQIIDNLTEQLLSMKNETARLKEILGKSEQIKSQQSAEIEVLKQNSERDAYSHKCTIPEEIKLKIKHWKDMARSKKIELDMIALENVKLKEQLSKTYQLPPTHDEGRSSREFEIKIKELQEKLHEATNEIERSAIIINTLKAEIRQLKSVIEETPDPVSEVRNESDDGKQRAIIRRLRKKNIDLIASLHGADEVLIAREKELSEVTAQLQLIQSEEGVSVLIEGLKNKKNQLKIKDEGIKSLVQEVNTLHQLVTDLQLENETLRQKYNIPFDERVCTKGILKKYRDMELLNAKMKNELKHVENKIIDLELNERCMSSKIIKLKKILTLQGYNVDDAYLNAEDDEYNEEILSGAKESLAIDQSINLVQHVKSSNETENIQAIIDENEGLRKALQELLDFLKDNSSTSSGVLALQCPSLESILQKMGIRHAAGWFSPHMSTFMELEAARGGKEALLLALHEARKETFNLMKNLSHQSKINEDLQKKVNELESQSVQNFDLEDNLFEFGSWVTEEEINSVDFYDKEQLQDSVHIKSQLMYENTLKKVLKHFHDQFKVLYDKMNSLAIEHIDKNNHWLIQEERYKAEIENLKIRLQQNEDEDFSNASPGLLPTSNTSMLERRCSYLEDSYKDIRNINENLRNENIECKREKTLVVSENEIKTQKLLLLICDITDKLRSSIALDLFWDQNRLLNEVTLKYRKIAENTFKDKNKTMDMLKCLEESKSEIINYVQKQLCENVGDADRRQILNEVEQLAIEKQLRQSITELEKREKEINLLESKYMELNQLQAGLIDDSLRSVNTEEINFMKSQISNLSAERKILKEQYQSTKDQLEVTILQLQEFQQRQMCKEIEVNILRHQILDLQSTGNNKAVVARLSSELLVTHLQASEYNRKIQELTTALNKEKEMRADIEDILSTRQKVFDLYTRRYDSKFKHIHTVLNIMRLQYQGSLPLTSIENFVSKLEDLSRKNHAINQQLTEVDELRTSLVTKHAVFDQILDVSKDKCLLQEDDCPHKLKSFIMDATHAREMDNMKKKIKISEQVREELLSQCTNLEKTLAYINQGYEKYTSVELKHKLKEVQNDEAINLEDLVSDEEPDSRSSRIAKSQILKPTTHTKATVTDINNEHLQENLFGSPAKKLPVTQLKPKVANVFVQTDQLTLCKSEKNIQTEEDALIIDMKYSIESARNDIKIKMRELDEALLVAKKRTEEMLIMESEKIDIQSKIKNLHHTIKEKDNLNNQLQKTLSELRKQVEVSQNLQIEEIDKIKHLENEETKKLLSALKELENDKNKIIEEYKQLLYNEREEYTKAMKELQVKLFELQTKLDRYIHKWNKAFFEVA

Summary

Description
Involved in early and late steps in cilia formation (PubMed:21565611). Its association with CCP110 is required for inhibition of primary cilia formation by CCP110 (By similarity). May play a role in early ciliogenesis in the disappearance of centriolar satellites and in the transition of primary ciliar vesicles (PCVs) to capped ciliary vesicles (CCVs). Required for the centrosomal recruitment of RAB8A and for the targeting of centriole satellite proteins to centrosomes such as of PCM1 (By similarity). Required for the correct localization of ciliary and phototransduction proteins in retinal photoreceptor cells; may play a role in ciliary transport processes (PubMed:16632484). Required for efficient recruitment of RAB8A to primary cilium (By similarity). In the ciliary transition zone is part of the tectonic-like complex (also named B9 complex) which is required for tissue-specific ciliogenesis and may regulate ciliary membrane composition (PubMed:21725307). Involved in regulation of the BBSome complex integrity, specifically for presence of BBS2, BBS5 and BBS8/TTC8 in the complex, and in ciliary targeting of selected BBSome cargos. May play a role in controlling entry of the BBSome complex to cilia possibly implicating IQCB1/NPHP5 (By similarity). Activates ATF4-mediated transcription (By similarity).
Subunit
Part of the tectonic-like complex (also named B9 complex) (PubMed:21725307). Interacts with ATF4 via its N-terminal region (By similarity). Associates with the BBSome complex, interacting (via N-terminus) with BBS4 (By similarity). Interacts with IQCB1/NPHP5; IQCB1 and CEP290/NPHP6 are proposed to form a functional NPHP5-6 module localized to the centrosome. Interacts with NPHP4; the interaction likely requires additional interactors (PubMed:21565611). Interacts with ZNF423, FAM161A, CEP162, CEP162, CEP131, TALPID3, CCDC13, CC2D2A, RPGRIP1 (By similarity). Can self-associate (homo- or heteromeric) (By similarity). Interacts with CCP110; required for suppressing cilia formation (By similarity). Interacts with RPGR (PubMed:16632484). Associates (via C-terminus) with microtubules; association to microtubule is reduced in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock, in a process that requires p38 MAP kinase signaling (By similarity). Interacts with FAM161A (By similarity). Interacts with PCM1 (PubMed:17705300). Interacts with CCDC66 (By similarity).
Keywords
Activator   Alternative splicing   Cell projection   Cilium   Coiled coil   Complete proteome   Cytoplasm   Cytoplasmic vesicle   Cytoskeleton   Nucleus   Protein transport   Reference proteome   Transcription   Transcription regulation   Transport   Ubl conjugation  
Feature
chain  Centrosomal protein of 290 kDa
splice variant  In isoform 2.
Pfam
PF16574   CEP209_CC5
Interpro
IPR026201   Cep290        + More
IPR032321   Cep209_CC5       

Ontologies

Topology

Subcellular location
Cytoplasm   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Cytoskeleton   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Microtubule organizing center   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Centrosome   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Centriolar satellite   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Nucleus   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Centriole   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Cell projection   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Cilium   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Cilium basal body   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Cytoplasmic vesicle   Displaced from centriolar satellites in response to cellular stress, such as ultraviolet light (UV) radiation or heat shock (By similarity). Found in the connecting cilium of photoreceptor cells (PubMed:16632484, PubMed:23943788), base of cilium in kidney intramedullary collecting duct cells (PubMed:16682970). Localizes at the transition zone, a region between the basal body and the ciliary axoneme (PubMed:21725307). Localization at the ciliary transition zone as well as at centriolar satellites is BBsome-dependent (By similarity).   With evidence from 2 publications.
Length:
1384
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1384
 
 

Population Genetic Test Statistics

Pi
25.469812
Theta
200.870322
Tajima's D
-1.81374
CLR
3.211423
CSRT
0.0277986100694965
Interpretation
Uncertain
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号