SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05121
Pre Gene Modal
BGIBMGA001459
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.465
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCACTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACCTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAACTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCTCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGATCAGAATACTAGTAGTGGTACGCCACAAGAGCGTGAATGCAGCATACGGAAGTCGTGTAATAACGTCTCTGTTACCTCGATGGAAGATCTGAGCCACGAAGAAATCGTCACATCTTACGTTCTGGCTCATGTTGCCCAGTTTGACTGTCGACGTCATCACATGGCGTTTACTAACGGAAATACAACACGTATCAAGCTATTGCAAGAAATTAAGGCAAGTGCAAATCTCAAGTGA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMYDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLDQNTSSGTPQERECSIRKSCNNVSVTSMEDLSHEEIVTSYVLAHVAQFDCRRHHMAFTNGNTTRIKLLQEIKASANLK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1631
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.78225
Exp number, first 60 AAs:
0.00071
Total prob of N-in:
0.00011
outside
1  -  1631
 
 

Population Genetic Test Statistics

Pi
110.435223
Theta
1.124601
Tajima's D
1.297822
CLR
199.591884
CSRT
0.8027598620069
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号