SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05023
Annotation
PREDICTED:_uncharacterized_protein_LOC105841489_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.335
 

Sequence

CDS
ATGATTAATAACAGCTTCCAGTTAATATTGGAAAGTAATGCTCATGCCGACAGTAATCTTTTAAAATACGCGAAATTCGCTCAACTACTAGCTATTATTAGCGAGAACGCCGAGGACTTATTTGTAGAGTTAAGTAGAACAGAAAATGTTCTAGCTTTTATTCGTGCATCAAGCACTCATCATAGCATGTTAGGTATAGAAAACTTAAGGATTATGATTAATAAGCTTATATTAGTATACGGTCAGGAACAGGTGCTACAGGCAGAATTAAGGGAGTACTACGACGTGATAAAATCAGGATACTATTATGCAGGAAATAAAATAATCATTATATTCAAATTTCCTATTATCTCTCCTAGCAAATTTGAATTTTATAAGCTTTCACTTGTCCCAAATAGAAACTTAAAGACATATGTCCCACCTTACCCATTCCTAGCAACCAATGGTGTAACTTTCATGTACGTAGAATCAGAATGTCCGAAATTCAACCAAGAACATATATGCGAAGAAAAGATAAAACACATATCTAGAGGAGACCCAGATTGCGTCGAGAGCATCGTCAGCCACCAATCCCTGGACAATTCATGCCGACCTACCAAAGTAACTTTCGACAAGGAAGCGGTGGAACAGCTAGATGATCAGCACTATACACTCATCTTTCCCAAAACCACGAAGACAGAGCTTCAGTGTGAACGACAGCAGTTCATCAACCTCCATGGGAGTTACCTCGCCACCATACCACATAAATCCCTTTTGCGCACTGCAGAATTCACTATAATCAATATCAACGACCGAGTGAAAGGACAACCACTACTGATAACTGAGATACCTCACAACTATGAAACCATCGATACTAAAGAAATTCAACACATAAAACTCAACTCCATCAACTTAAAAAGTCTACAGTCTATACAAGATAAAATTATAATGCAGCAGCCAATCCAAAGGGACCACACGGATATAGCAATATACCATACAACCATTCCCTTGTACGGAGCTCTGGCCGTAGCAATCGTTATTATTTCTTCATTCATCCTGAAACGATACAAATTGAAACCGAAACCAATAAAGAAGATTCCTCCATCTCAAATAATGACAGCTCGAAGCCATGAATCTGAAGATCTTGAAAATTCAGAACATCAAGATCCAAGGACAGCAACATTTGACCTCAAGGTGCTCAAATAG
Protein
MINNSFQLILESNAHADSNLLKYAKFAQLLAIISENAEDLFVELSRTENVLAFIRASSTHHSMLGIENLRIMINKLILVYGQEQVLQAELREYYDVIKSGYYYAGNKIIIIFKFPIISPSKFEFYKLSLVPNRNLKTYVPPYPFLATNGVTFMYVESECPKFNQEHICEEKIKHISRGDPDCVESIVSHQSLDNSCRPTKVTFDKEAVEQLDDQHYTLIFPKTTKTELQCERQQFINLHGSYLATIPHKSLLRTAEFTIININDRVKGQPLLITEIPHNYETIDTKEIQHIKLNSINLKSLQSIQDKIIMQQPIQRDHTDIAIYHTTIPLYGALAVAIVIISSFILKRYKLKPKPIKKIPPSQIMTARSHESEDLENSEHQDPRTATFDLKVLK

Summary

Pfam
PF12259   Baculo_F
Interpro
IPR022048   Envelope_fusion-like       

Ontologies

Topology

Length:
394
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.63546
Exp number, first 60 AAs:
0.00045
Total prob of N-in:
0.02833
outside
1  -  323
TMhelix
324  -  346
inside
347  -  394
 
 

Population Genetic Test Statistics

Pi
299.054893
Theta
218.338069
Tajima's D
1.154311
CLR
0
CSRT
0.701164941752912
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号