SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05014
Annotation
PREDICTED:_uncharacterized_protein_LOC105841489_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.03
 

Sequence

CDS
ATGACCTTTCACGTGACACTGGCGCACGAGATAAGGCTGGAAAGCCTTGATGATGGACCCGGTGTTCTCCCTTTCAAACTCGGCAATGCCAGACTTATTACGCACTACCATTCCTTCATACAATACATTGAATTGAACGACATAAACGACAGACTCGACTCTGTGGACTCACAGCTTAAGTCCTTTGAAACGAAGCTCACTAACGATACATACTTATTATACGAGTTGCAAATAAATTATCTCCTAGGTAAAATTGATAAAATTCGGAAACAACTTAGTACCTTAGAACCAAGTAATCTAAGAAATAAAAGAGGCCTTGTAGACGGTTTGGGATCCCTGGTTAAAAGCATTACGGGTAATTTGGATCACACTGACGCTGAAAAATACAATAAAGCTATCGAAATTCTAGAACGCAACGAAAATAAGTTAACATCTGCAATTAATGATAATGTCAGTTTCAATAAGGAGTGGATGAGCCAGCATACAGCTTTGCTTACTAAAATAACAGAAAATCAAATTATGATTAATAACAGCTTCCAGTTAATATTGGAAAGTAATGCTCATGCCGACAGTAATCTTTTAAAATACGCGAAATTCGCTCAACTACTAGCTATTATTAGCGAGAACGCCGAGGACTTATTTGTAGAGTTAAGTAGAATAGAGAATGTTCTAGCTTTTATTCGTGCATCAAGCACTCATCATAGCATGTTAGGTATAGAAAACTTAAGGATTATGATTAATAAGCTTATATTAGTATACGGTCAGGAACAGGTGCTACAGGCAGAATTAAAGGAGTACTACGACGTGATAAAATCAGGATACTATTATGCAGGAAATAAAATAATCATTATATTCAAATTTCCTATTATCTCTCCTAGCAAATTTGAATTTTATAAGCTTTCACTTGTCCCAAATAGAAACTTAAAGACATATGTCCCACCTTACCCATTCCTAGCAACCAATGGTGTAACTTTCATGTACGTAGAATCAGAATGTCCGAAATTCAACCAAGAACATATATGCGAAGAAAAGATAAAACACATATCTAGAGGAGACCCAGATTGCGTCGAGAGCATCGTCAGCCACCAAACCCTGGATAATTCATGCCGACCTACCAAAGTAACTTTCGACAAGGAAGCGGTGGAACAGCTAGATGATCAGCACTATACACCCATCTTTCCCAAAACCACGAAGACAGAGCTTCAGTGTGAACGACAGCAGTTCATCAACCTCCATGGGAGTTACCTCGCCACCATACCACATAAATGCCTTTTGCGCACTGCAGAATTCACTATAATCAATATAAACGACCGAGTGAAAGGACAGCCACTACTGATAACTGAGATACCTCACAACTATGACGCCATCGATACTAAAGAAATTCAACACATAAAACTCAACTCCATCAATTTAAAAAGTCTACAGTCTATACAAGACAAAATTATAATGCAGCAGCCAATCCAAATGGACCACACGGATACAGCAATATACCATACAACCATTCCCTTGTACGGAGCTCTGGCCGTAGCAATCGTTATTATTTCTTCATCCATCCTGAAACGATACAAATTGAAACCGAAACCAATAAAGAAGATTCCTCCATCTCAAGTAATGACAGCTCGAAGCCACGAATCTGAAGATCTTGAAAAGTCAGAACTTCAAGATCCAAGGACAGCAACATTTGACCTCAAGGTGCTCAAATAG
Protein
MTFHVTLAHEIRLESLDDGPGVLPFKLGNARLITHYHSFIQYIELNDINDRLDSVDSQLKSFETKLTNDTYLLYELQINYLLGKIDKIRKQLSTLEPSNLRNKRGLVDGLGSLVKSITGNLDHTDAEKYNKAIEILERNENKLTSAINDNVSFNKEWMSQHTALLTKITENQIMINNSFQLILESNAHADSNLLKYAKFAQLLAIISENAEDLFVELSRIENVLAFIRASSTHHSMLGIENLRIMINKLILVYGQEQVLQAELKEYYDVIKSGYYYAGNKIIIIFKFPIISPSKFEFYKLSLVPNRNLKTYVPPYPFLATNGVTFMYVESECPKFNQEHICEEKIKHISRGDPDCVESIVSHQTLDNSCRPTKVTFDKEAVEQLDDQHYTPIFPKTTKTELQCERQQFINLHGSYLATIPHKCLLRTAEFTIININDRVKGQPLLITEIPHNYDAIDTKEIQHIKLNSINLKSLQSIQDKIIMQQPIQMDHTDTAIYHTTIPLYGALAVAIVIISSSILKRYKLKPKPIKKIPPSQVMTARSHESEDLEKSELQDPRTATFDLKVLK

Summary

Pfam
PF12259   Baculo_F
Interpro
IPR022048   Envelope_fusion-like       

Ontologies

Topology

Length:
567
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.85855
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00518
outside
1  -  496
TMhelix
497  -  519
inside
520  -  567
 
 

Population Genetic Test Statistics

Pi
433.340508
Theta
242.387542
Tajima's D
2.48144
CLR
0.077924
CSRT
0.944552772361382
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号