SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05009
Pre Gene Modal
BGIBMGA014408
Annotation
polyprotein_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.182 Nuclear   Reliability : 1.686
 

Sequence

CDS
ATGGAAGGTATCACAGGAAAGCTTCAGATCGGCCTCCTAGATGGAAAAAACTGGGACACCTGGAAATACAAAGCCTTATGCTTACTACGCACCGTACCGTCGGCCCTAGAAGTAGTTGAAGGATCGTTCCAGGAGCCTACTCGTCCACCTACCGGATGCGGCGATGCTGAATTGGCGGCTTATCAACAACAAAAAGATAAGTTTGATAAAGCTGATGCCAGCGCTATCCTAATACTTACCACCAATATGCAAGAAGACACACTTCGAAAAGTTATGCGGTTCACTAAAGTACGTGATGTCTGGTTAGAGCTCCACAGGCTGTTCGACGGAACAAATGCGGACAAAACCTACAACCTGTGTATGAGTTTCTTCAGCTTTAAAAGGGATCAAGCAGACGACATAGCCACTCACATGTCAAAATTAAAGAACATTTGGACTGAACTGAATCAAGAACTCAAGAAGGACAGTAACCAAGAGCTACCCGAACTGCTACTTGTTTGTAAGATACTGGACACGCTTGATGATTCATACTTCAGCTTCAGAAGTAGTTGGCTCCTACTGCCCAAATCCAACCGTACTGTAGAAAACCTAACTAGTCATCTCTGCGCATTTGAAAGGGCACTGCAAGGTATCAACGTACCTTCGCATCATTCGGAAGCCCTGGTTTCGAATACGGAAAAGAAGAAGGACAAGAAGCTTAAATGCAACTACTGCCTAGGTATTGGCCACAGAGTACGCAACTGTCAAAAATGGATCCGTGACGGTAGACCTCCTAAGAGCCAAAATCCGACCCAGACAGCAACGCCTTCTACTTCAAAGACCGCTAATTTGTTACTCATGTCTTTAGAAGACAACGAAATCTTCACAGTTTCACGGGACAACGAGAACTGGTACATCGATAATGGTGCAACAAGCCACGTCACCAACAGAGCTGATTTTTTCCAAACCTACGAACATTTCAATGAGAACTACACTGTTACAACGGCCGCTGGTAATGAAGTCCGTGCCAAAGGCAAAGGAACAGTACAGCTCAGAGGATATGTTAACGGGAAACAAATCGACATCAGCCTGCAAGACGTCTGGTACGTTCCGGCCATAAGCAAGAACCTCTTCTCCATACTCGCACTTCACGACCGAGTCCCGAATAGCACTTTTTCATCCAGGACAACTGAATGCAACGTCATTGTCAACGGGAAAGTATGCTTAATAGGGAAGAGACAAAAACAAGGTGGCTTATATCGACTGGAAGTAAAACCCGTACTGCCAGAAAAACCACCCGAAGTCTTTGCAACTACAGCAACGATGCAACTGTACCACGAGAGACTCGCTCACCAAAATAAAAGACACGCAAGAGCGACGATCCAACGCGAACTAGGTCTAAACCTGCCGATAAATAAAGAGACCTGTGAAGGCTGCATCTTTAGAAAGGCGCATCGACTTAAATTCGGTACAAGAACCCGAGCTACCGCGCCCGGAGAAATTGTACACACCGACGTTTGCGGACCGTTTCAATCTAGCTTCTCAAGCTATAAGTACTACGTTCTGTTCAAAGACGACTTTACTGGCTATCGTATGGTGTACTTCATACGCAATAAGTCGGACACACCATAA
Protein
MEGITGKLQIGLLDGKNWDTWKYKALCLLRTVPSALEVVEGSFQEPTRPPTGCGDAELAAYQQQKDKFDKADASAILILTTNMQEDTLRKVMRFTKVRDVWLELHRLFDGTNADKTYNLCMSFFSFKRDQADDIATHMSKLKNIWTELNQELKKDSNQELPELLLVCKILDTLDDSYFSFRSSWLLLPKSNRTVENLTSHLCAFERALQGINVPSHHSEALVSNTEKKKDKKLKCNYCLGIGHRVRNCQKWIRDGRPPKSQNPTQTATPSTSKTANLLLMSLEDNEIFTVSRDNENWYIDNGATSHVTNRADFFQTYEHFNENYTVTTAAGNEVRAKGKGTVQLRGYVNGKQIDISLQDVWYVPAISKNLFSILALHDRVPNSTFSSRTTECNVIVNGKVCLIGKRQKQGGLYRLEVKPVLPEKPPEVFATTATMQLYHERLAHQNKRHARATIQRELGLNLPINKETCEGCIFRKAHRLKFGTRTRATAPGEIVHTDVCGPFQSSFSSYKYYVLFKDDFTGYRMVYFIRNKSDTP

Summary

EMBL
AB378753    BAG68376.1    GDQN01003581    JAT87473.1    KK113102    KFM59342.1    + More
KK112589    KFM58020.1    NEVH01023958    PNF17740.1    GEZM01078128    GEZM01078127    JAV63002.1    GEZM01099106    GEZM01099105    JAV53487.1    JYDO01000312    KRZ65659.1    JYDQ01000330    KRY08494.1    GEZM01048830    JAV76369.1    JYDH01000102    KRY32233.1    KRY32232.1    JYDW01000105    KRZ55879.1    LBMM01012672    KMQ86059.1    JYDJ01000235    KRX39370.1    KRX39371.1    JYDM01000206    KRZ83588.1    ABLF02020242    ABLF02020246    ABLF02042026    KQ971352    KYB26731.1    JYDP01000075    KRZ09245.1    GGMR01012789    MBY25408.1    GEZM01017328    JAV90763.1    GEZM01098859    JAV53706.1    GEZM01013586    GEZM01013585    JAV92450.1    ABLF02057951    ABLF02066512    GEZM01017329    JAV90762.1    GEZM01007166    GEZM01007165    JAV95327.1    KQ981003    KYN10396.1    JYDK01000164    KRX73801.1    JYDK01000219    KRX72067.1    LBMM01011114    KMQ87021.1    JYDK01000253    KRX71152.1    GEZM01073374    JAV65135.1    JYDT01000007    KRY92484.1    ABLF02042030    NEVH01009420    PNF33053.1    KL367545    KFD65036.1    JYDV01000001    KRZ46164.1    LBMM01012449    KMQ86217.1    ABLF02042028    JYDR01000003    KRY78530.1    LBMM01008433    KMQ88885.1    AAZX01004352    AAZX01012276    JYDR01000237    KRY65040.1    GDIQ01125974    JAL25752.1    AAZX01000127    GEZM01005616    JAV96038.1    JAV65136.1    LBMM01016284    KMQ84481.1    LBMM01012696    KMQ86054.1    GBHO01008809    JAG34795.1    GBHO01038256    JAG05348.1    AAZX01010628    AAZX01013403    KL367684    KFD60227.1    LBMM01012772    KMQ86003.1    GEZM01063091    JAV69316.1    JRES01000163    KNC33708.1    AAZX01023229    NWSH01001522    PCG70967.1    LBMM01012830    KMQ85968.1    ABLF02016448    LBMM01008998    KMQ88473.1    GEZM01078105    JAV63008.1    KQ979396    KYN21742.1    JYDV01000213    KRZ24707.1    LBMM01010133    KMQ87653.1    GDIP01019956    JAM83759.1    GDIP01039936    JAM63779.1   
Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
PF00098   zf-CCHC
PF13961   DUF4219
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR012337   RNaseH-like_sf       
IPR013103   RVT_2       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR025314   DUF4219       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
536
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00608
Exp number, first 60 AAs:
0.00033
Total prob of N-in:
0.00100
outside
1  -  536
 
 

Population Genetic Test Statistics

Pi
8.403482
Theta
12.393585
Tajima's D
-0.952177
CLR
24.295354
CSRT
0.147492625368732
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号