SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05008
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 3.655
 

Sequence

CDS
ATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAATTAACATATGCTAATGCTGTGGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACGTCACAGAATTAAAAAAATTATCAAAAAATTGTGAGTTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGTGCAGTTACGTTAGCTTTGTCATTGGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAAAGGGCTTAAGAATCAGGCGAAGGCAGCCGGGGGTTCACCACGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGACAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATCATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGGTGTGTATTAAAGTTAAAGTCCAAAATTGCTTGCTCAAGATGGAGGTCGATACTGGATCGGCGTTATCTTGTATTAGCAAGAATGTTTATGATAAATATTTTTCTAAGGAGAAGTTACAGGCATGCTTATTAAATTTAAAATTTTACGATGGCTCAATCATTCGGCCTTTAGGGTTTATAAACACTATAGTGAAGTACCAAGGTGTTTCAAAAATGTTAGACTTGTATGTCATAGACAAAGGAACGACTAATCTATTGGGCCGACGATGGTTAGCTGAATTGAATATTCCTATAAAAATATCAAAACCTACGAGTTTTAAAATACAACACAGTAACTTTGTAACCGAACACGCACGAGACTATAATAAATTAATTAATGAAATTATTTCTAGACATAAATCCTTGTTCGACGGCACATTGGGTAAATACACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGGTCTGAGAATATGTGCGGACTATAAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTTAAATCAATAGCAACAATGCTACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGAACCGATTTGTAATAAAATTACTTCAGTTGAAGCAGAAGTAGCCGTTGTTTCTGTAACTTCGAGGATTCCTGAGTTTTGGTGCGACCAACCACGCTTATGGTACGTGCAATGTGAAGCTATCCTAGCACCGCAGAAGTTAAGTGATGAGGCCCGATACAACCTAGTTGTTACTAAATTAGGCAAGGACGTCGTACAACAGGTCAGTGACATTCTATTAAAACCACCTGATGAGAAGAAATTTGATACGCTGAAAGAACGTTTGTTAAAAATCTATGAAGAATCGGAGATGAGACAATTTCAAAAATTGCTTAGCGAGATGGAGTTGGGGGATCAGAAGCCCTCTCAACTCTTGCGCCGTATGAGGGATCTGGCTCGCGATAAAATGCCCGATGAGACCCTTAGAATTATGTGGCAAGGTCATCTATCCGCGGCAGTTCGAGGAGTGCTAGCAGTCTGCGAAGCAAAAGACTTAGAGCACCTGTCGGCAATTGCGGATAAAGTCATCGAGACGACGCAGCCCTTGCAAGTGTCTGAAGTACAGAGCACTCCTGGCAGTAGTTCCAGTACTGACCATAGCTTTATACTGGCGGAGATAGCCAAATTAAGCTTAAAAATAAGAGAGATGGAGCAAAGTCGCAATTTTCACCGTTTTCGACCGCGATCACGGTCATCATCACGTAATCGTAATACGAGTCGACGTTCACCGAGCAGCCCGGACTGGCTATGTTTTTATCATTTTAGATATCGCCATAGAGCTAGAAAATGTGTAGAACCGTGTGCCTGGAAAAAGCCAGTGATTCAGGAAAACTGA
Protein
MGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYVTELKKLSKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKKGLKNQAKAAGGSPRTGRRGNRGAGGNRRSWRGQRGAGRGGRERAPLHLLYDQNNDDTSYNNFNNEQDGCGEENEPMYQMTLSNYKPVCIKVKVQNCLLKMEVDTGSALSCISKNVYDKYFSKEKLQACLLNLKFYDGSIIRPLGFINTIVKYQGVSKMLDLYVIDKGTTNLLGRRWLAELNIPIKISKPTSFKIQHSNFVTEHARDYNKLINEIISRHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGGLRICADYKDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMLHPNNVTELKSFIEPICNKITSVEAEVAVVSVTSRIPEFWCDQPRLWYVQCEAILAPQKLSDEARYNLVVTKLGKDVVQQVSDILLKPPDEKKFDTLKERLLKIYEESEMRQFQKLLSEMELGDQKPSQLLRRMRDLARDKMPDETLRIMWQGHLSAAVRGVLAVCEAKDLEHLSAIADKVIETTQPLQVSEVQSTPGSSSSTDHSFILAEIAKLSLKIREMEQSRNFHRFRPRSRSSSRNRNTSRRSPSSPDWLCFYHFRYRHRARKCVEPCAWKKPVIQEN

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
823
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00547
Exp number, first 60 AAs:
0.00474
Total prob of N-in:
0.00025
outside
1  -  823
 
 

Population Genetic Test Statistics

Pi
2.989869
Theta
15.109497
Tajima's D
0
CLR
0.427885
CSRT
0.370581470926454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号