SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04998
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.169 Nuclear   Reliability : 1.061
 

Sequence

CDS
ATGGATCACGTCCATCGCTTCCTCCAAGCCAACGTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTTCATCGACATCGCGATCGTTGCGGAGCCATACTTCGTACCTCCCGACCGGGAGGATTCCTGGGCCGGAGATGTTGATGGCTCCGTGGCGATCGTGATGCGACAGTCAGCGGCGCTACCCCCCCTTGGAATGGTGGCCAGGGGATCCGGCGTGGGGCTCCCCCGCACGGACTCGCGCGGCGAGTTCCTGTCGGAGTGGGCTTTCGCGACCGGTCTCTGTCTTCTGAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTGTCGTTCGCGTCTCCGTCCGCCGCACGCCGTGTCCGTGGCTGGCGTGTTCTCGAGGGGGCGGAGACGCTCTCGGACCATCGGTTTGTTCGATTTGAGCTCTCCGTTTCCACTTTGTTGAATGCGCCGGCCGAAGACGCCCGCGGTGAGGAGGAGCTCCCGCGTAGCGCTCCCCGATCATTCCCACGATGGGCACTGAAGCGCCTGAATAAGGTGCTCGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTCGGAGGCCGATTGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGTGGCCGCGCCCCACGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCACTCCTCAGAGAGGAGTGCGTGCGGGCACGCCGCCGAAACGCCCGCCACCGCCGTCGCCGTCTTCGCGGTATGGATTTCGCGGAGGTGGCGGCCCGCTTACATGCCGACTGCCGTGAGAAGCAGGAGGCTCTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTCGATCAGGATCCCTGGGGGCGCCCGTACCAGACGGTACGCAAGAAATTGCGACCGTGGGCGCTCCCGGTGACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGATATTGTCTCCGGGCTATTCCCGCGGATGGAGAGGGACTTTGAGCCCCCCTTCATGGGCGTGCCGCCACGCCTTGACGCGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGCATATCGGAGCAGGAGATGCGTGCGGCCGTGTCGAGGATGCGGAGGAAAGACGCGGCCCCCGGCCCTGACGGTGTTCACGGTCGGGTTTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCCTCGAGTCGGGGCGGTTTCCAAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCTGCGGACTCACCTGCGGGGTATCGTCCCATCGTGTTGCTGGACGAGGCGGGAAAACTGCTCGAGCGAGTGGTGGCCGCCCGCATCGTCCAGCACCTGACGGGAGTGGGTCCTGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATTGACGCGGTGATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCAGCCGGGGCGGGGTTGCACTGGCGGTGTCCCTGGACATCGCCAATGCGTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGCAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGATAGGTCGGTCGTGTGCACCGGGCACGGTGGGACGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCTTGCGTGGCACCCTAAGCACTCCTCTCCCGGGTCTGAGCGTAGTTTGCTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGACGGTTGGGTCTGGAGGTGGCGCTTGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTAGTGCGTCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGTGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTAGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAACTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCACCTACGGGCGACGGACTGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGTCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MDHVHRFLQANVNHSARAQDLLVHTMAEWFIDIAIVAEPYFVPPDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGVGLPRTDSRGEFLSEWAFATGLCLLNRGSVATCVRWNGESHVDVSFASPSAARRVRGWRVLEGAETLSDHRFVRFELSVSTLLNAPAEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVDVESEADWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRNARHRRRRLRGMDFAEVAARLHADCREKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLRDIVSGLFPRMERDFEPPFMGVPPRLDASGDAPAEVVPPSISEQEMRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVSRGGVALAVSLDIANAFNTLPWSVIAGALQYHGVPAYLRRLIGSYLEDRSVVCTGHGGTVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRGTLSTPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPTYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078935    BAC06462.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    AB078936    BAC06464.1    RSAL01003504    RVE40273.1    LBMM01006954    KMQ90166.1    AGBW02011529    OWR46521.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01008448    KMQ88867.1    LBMM01006657    KMQ90417.1    LBMM01007036    KMQ90099.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01007425    KMQ89740.1    LBMM01003988    KMQ92922.1    LBMM01004634    KMQ92224.1    LBMM01012412    KMQ86235.1    LBMM01008422    KMQ88894.1    LBMM01008278    KMQ89009.1    LBMM01014122    KMQ85315.1    LBMM01015285    KMQ84870.1    LBMM01002480    KMQ94776.1    LBMM01004262    KMQ92649.1    LBMM01005474    KMQ91485.1    LBMM01004505    KMQ92346.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02034925    GGMR01015159    MBY27778.1    ABLF02011238    LBMM01008445    KMQ88871.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GFXV01002090    MBW13895.1    LBMM01005733    KMQ91252.1    GALA01001777    JAA93075.1    GGMR01006838    MBY19457.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01004600    MBY17219.1    GGFK01005660    MBW38981.1    GGFJ01001369    MBW50510.1    KU543683    AMS38371.1    LBMM01005465    KMQ91492.1    GGFJ01001370    MBW50511.1    LBMM01004261    KMQ92650.1    GAKP01002292    JAC56660.1    LBMM01006977    KMQ90149.1    GGMR01012748    MBY25367.1    LBMM01008226    KMQ89040.1    ABLF02041886    GFXV01003903    MBW15708.1    AB593325    BAK38646.1    AB090815    BAC57906.1    GGFJ01001727    MBW50868.1    ABLF02023257    KQ971309    EEZ99146.1    ABLF02018808    GGFL01004044    MBW68222.1    GGMR01019493    MBY32112.1    GALA01001776    JAA93076.1    ABLF02011183    ABLF02041884    AJ278684    CAB99192.1    GALA01000302    JAA94550.1    ABLF02007989    ABLF02014650    AB593327    BAK38648.1    AB593321    BAK38639.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001439    MBW50580.1    ABLF02018942    ABLF02041885   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=2.49401e-05,     Score=118

Ontologies

Topology

Length:
1023
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.243040000000001
Exp number, first 60 AAs:
0.22435
Total prob of N-in:
0.01078
outside
1  -  1023
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.562259
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号