SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04989
Pre Gene Modal
BGIBMGA008108
Annotation
TRAS3_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.69 Nuclear   Reliability : 1.178
 

Sequence

CDS
ATGTTCGGCCATAGAACGCCACCAACAAAGCGCAGCAGCGCAGGTGATAGATCAAACAGTGGTACTGACCGGGTAGTCCTGAGGCAGAGTAAGGAGTGGGAGGAGGGGAGACCCAGTCCGGTAACTGGCTCCCCCCCTGAACAATCTGGGGCGCAAACGACCACGATAGCCACTAGGACAGGGACTGTATCGCCAAAAGGCGACACTCAACTGACTCCGGGTACTTCCAGTGCACCCGCGCGAGTGCCGCTCAAACCTAGGACGGCACTGGCGCGTACGCCCCCCGTGTCCAGCCACCCGGTGGCTATAAGTGAGCCGGGACCGCCCTCCCCTTCCACAACGATAAAAGCCTCGCGATTAAAACAAGCGAGAGCCAGCGTTACCAGGGCAAAAACAAAAATCGGTCAATCGCGGAACCTGAGGAATGAAATCAGGGAGGATGTAACGAATGCGATTGATGAGCTATACACAATTATAAAGGCCTTGGACGCAGAGCTAAGAGGACTAGGTGGTCTAAATACACAAACAGCAAGGCTAGAGCTTTCTCCTGCCCCGACCAACGCCGGCTGCGTCGATAGGGACATGAGCGATAAGCTCTTGGGGAAGCTGGAGGAGCACTCCGTCCTCTTAAAAGAGAACGCACGCAGTCTGGAGCTGCTGAGGAGCGCGGTGGAAACGCAGACGGAGAGCGTCTCAAAAATGACGTACGCGAGTGTAGCGGCAGGACCCCCAAGTGGGCGCCTCCCAGGGAGGGCAGCACTGCACTCCGTCGTCATTACCTCGAAGGAGGCCTCGGACACCGGGGACGAGGTCATGGACAAGGTGCGCAGGGCAATCGACGCAAAGGGGGGGGGAATAGAAATAGAGAGGGTTAGGAAGGGGAGAGACAGAAAGATAATTATGGGGTGTAGAACGGTGGAGCAACGGGAAAAAATTAAAGAGAAAATAAATAAAGCAGGAAAGCACCTCGTCGTTGAGGAAGTAAAAAACAAGGACCCCATGCTGGTTCTGAGGGGAGTCCTAAGCGTCCACACGGACGAGGACATTTTGGAGGCCCTGAAGAACCAAAATGGGGATGTTTTTCGCGGCCTCAGCGACGGAGAGGCTAGGGTTGGGGTAAAGTTTAGGCGTCGTGCCCGAAACCCGCACACAAATCACATCGTCTTGACAGCGTCTCCGGTAGTTTGGAGGAGAGCGCTGGAGAAGTCTCGCCTCTGGGTCGACATGCAGGCGGTGCCAGTGGAGGACCAGTCGCCGCTAGTGCAATGCACTCGCTGCCTGGGATACGGGCACGGCAGGCGCTTCTGTAAGGAAGCAGTTGATATCTGCTGCCACTGTGGTGGCCCACATCTCAGGGCAGAGTGTCCGCACTGGCTGGCGGCGGAAGAACCGCAGTGTAGGAACTGCGTGTTGGCCAAGATGGCACACTGCGTCATGCCAACGGAAAGGACTCCCCACAGGATACTCCAGGCAAATCTACAAAGACAGAAATTGGCAACTACCGAGCTGATGTTGGAGGCTACTAAACGGCAAGCAATCGCTGCTCTTCTGCAAGAGCCGTATGTGGGTGGCAATAAAAGTATGAGTGGTGTCCGGGGCGTAAGGGTCTTCCAGAATACCAGGATCGAGGAGGGCACTGTAAAAGCGGCAATAGCCGTCTTTGACGCTAATATTAGCGTTATACAGTACCCAGAACTCACCACCAATAACATCGTGGTGGTGGGGATTCGTACTGGTACCTGGGAAATCACGCTGGCATCGCTCTACTTCGAGCCGGACAAGCCTATAGAACCCTTTCTCGACCACCTAAGGAAGGTAGGAAAAGCCACCAACATCATCATCGGTGGCGATGTCAATGCCAGGAGTGTCTGGTGGGGAGGACCATCGACCAACAGCAGGGGCGAAGCGTTGCTGGGGGCCCTCGACGAGCTCGGTCTCCATGTCCTCAACCAAGGCGAAATTCCCACATTCGACGTAATCCGAGGGGAGCGACACCTGACGAGCTATGTCGATATCACGGCATGCTCACCGGATGTACTCGGCCTGGTGGACGATTGGCGAGTGCTGGAAGACCTGACGAGTTCCGACCATAATGGTATAGAGTTCAAAATTAATTTACACAAGTCCAAAGGACATACAGTACACAGAACCACACGCATATACAACACGAAAAAGGCAAATTGGGCCCAGTTTCGTGTGAAACTGGGCGAATTACTGCTGAGCACTACACTGAACAGGGACGCAATAAATAATATTAACACTATACAGGAAATTGAACAAATCACAGTAACATACACTAACACTATTACAAACGCCTGTACACACACAATACCACAAAAGAAAAATTTGGAGAAATTTTCTGTGCCATGGTGGTCGGAGGAGCTCGCCGGGTTGAAACGGCGTGTTGTCACCAGAAAGAGGAGGATCCGATGTGCCGCACTGGTCCGGAGGCCGAGGGTGGTGCAAGAGTACCTGGAGGAACGGGCAAAATACCGGGCTGCGATAAAAGAGGCCCAGATCGCAAGCTGGAAGGGGTTCTGCGAGAGGCAGGACCGCGAAGGCATGTGGGAGGGGATTTATCGGGTGATAGGCAGGGTTTCGAGACGGGAGGAAGACATACCCATGGAGCGGGAAGGGATAGTGCTGGACGCGGATAGTTCAGCCACGTACTTGGCTGAAACGTTTTATCCGGAGGACCTTACCGATTTGGACGATCCCGGGCATGGCGAGACGAGGAGGCGAGCCGCTGAACTAGATAGCGACAGTGGCGGCGCTCGAGACCCCCCGTTCACCATGCACGAGCTCGACAGATCGGTGAGGTCCTTCAACCCCAAGAAGGCTCCAGGCGCCGATGGATTGACCGCCGACATTTGTAAGGAAGCGGTCAACAGTGATCCCGAGCTGTTCCTGGCGCTCGTAAACAAATGCCTCGAGCTCCGTTACTTCCCGAAGGTGTGGAAGGCGGCCACGGTCATCATACTCAGAAAACCTGGCAAGAACAACTACGCCACCCCCAAAGCGCACAGACCGATTGGCCTTTTGCCTGTGCTGGGGAAGGTATATGAGAAGATGATAGTGGCACGTCTAAAGTACCATATTTTGCCGAGCATGAGCGCTCACCAATATGGCTTTATGCCACAGAGGAGCACCGAAGACGCCCTATATACCCTGTTGGAACGCATTAGAGAAAAGCTTCTTGACAAGAAACTGATCCTAATGGTCTCGCTGGATATAGAGGGGGCCTTCGACAGCGCCTGGTGGCCGGCCATAAAGGTGAGGCTCGTCGAGGAGTCGTGCCCGGTTGGTATACGGGGAGTAATGAATAGTTATATGAGCGACAGGACGGTTGGAGTCCGCTACATGGGCGCCGAACATCTGAGAGCCACGGGAAAAGGATGCGTCCAGGGCTCCATAGGAGGCCCTATCCTGTGGAACCTCTTGCTCGATCCTCTGCTTAAGGGACTCAGTACCAGAGGGGACTACGTCCAGGCGTTTGCTGACGACGTTGTCCTCCTCTTCGACGGGGATACAGCGATGGACGTTCAGAGACGTGCCAATGCCGCCCTCGAGTATGTTCGGGCGTGGGGTGTCATGAACAAGCTGAAATTCGCTCCGCACAAAACCTGTGCGATGGTAATCACGCGGAAGCTGAAGCATGACACCCCGCGCCTGAGCATGGGCGGGGTAGACATTGGCATGTCTAAGGAGGTACTGTTGTTAGGGCTCACCATCGACCATAAACTTACATTTAACACCCATGTTGCCAATGTTTGCGCTAAAGCCGCAAACCTATACAAAAGGCTAACCAGGGCAGCCAAAGTTGGCTGGGGTCTGCACCCCGAAGTTATCAAGACCATATACATCGCAGTGGTTGAACCCGTGATCCTGTATGCCTCGAGCGCGTGGGCGCCGGCCGCAAACAAACTGGGAGTGCGGAAGCGCCTCAACGCGGTCCAGCGTAGCTTCGCACAGAAGCTCTGTCGAGCCTACCGAACGGTATCCCTGAACTCAGCACTGGTGCTGGCAGGGGTGCTCCCCCTTGACCTACGCGTACGCGAGATGGCCTCGCTATACGTGGCCAAGAGGGGGGCGCATCTGCCGGTGCTGGGAGACAGGGATATCGAGCGGGTGGCATCGGCACTGGAGAGGCCTCATCCAGCGGAACAAGTTGGGATGGAGCTACGAAGCCTGGTAGACGAGGAGCAATACCTCGAACATCGAGGATATGAGGTGCGTATATTTACGGACGGGAGCAAGATTGAGGGCAAGGTCGGGGCCGCGCTATCCATCTGGACTGGCGAGGCCGAAGCCAAAACTCTCAAACTTGCTCTCTCGCCCCACTGTACCGTCTACCAGGCAGAGCTCTTGGCCCTTTGTGAAGCTGCAAATGAGATCAGCCGGCGAAAAGAGAACGTTTTCGCCATCTTCAGCGACTCCATGGCGGCCCTTCAGACAGTGGCTGACCCGGATTCCCTTCACGTCCTTGCGGTCCGGATGAGGGGCGCTCTTAGTCACTGCAAAACGCAGGGCAAGAGCGTCTCCTTGTTTTGGATTAAGGCTCACGCGGGACTTGAGGGGAATGAGAGGGCCGATGCCCTGGCTAAAGCGGCCGCCCTGAGGTTGAAGAAGAAACCCAACTATGACCGGTGTCCGGTCTCATTCGCGAAGCGTGTAATCCGCATGGACACGCTCGCCGAATGGGATCGGAGGTACAGCGCCGAACAAACGGCCTCAGTCACCAAGCTGTACTTCCCAATCGCGTCCGAGGCATACAGGATAATCAGAAATATCGAAATGACCAAGGAGGTAGCACAGGCCTTCACAGGGCATGGTGGGTTCTCCGAGTACTTGGCCAGGTTCAAGTGCAAGGAGAGCCCAGCATGCATCTGTGACCCTTACGTCGACGAGTCAGTGGCCCACGTGCTTCTGGAGTGTCCAGTCTTTGGCTCAGCACGATTCGACTTGGAGGTCGAACTGGGCCAAAGACTCCATGCGCGAAAACTCCCCAATTTAATGAAAAAAACCTGTGCGAGGAACTTGTTCCTAAAATATGCTATAAAAATTATAAAGGAGGTTAATAAAAGAAATAGAACATAA
Protein
MFGHRTPPTKRSSAGDRSNSGTDRVVLRQSKEWEEGRPSPVTGSPPEQSGAQTTTIATRTGTVSPKGDTQLTPGTSSAPARVPLKPRTALARTPPVSSHPVAISEPGPPSPSTTIKASRLKQARASVTRAKTKIGQSRNLRNEIREDVTNAIDELYTIIKALDAELRGLGGLNTQTARLELSPAPTNAGCVDRDMSDKLLGKLEEHSVLLKENARSLELLRSAVETQTESVSKMTYASVAAGPPSGRLPGRAALHSVVITSKEASDTGDEVMDKVRRAIDAKGGGIEIERVRKGRDRKIIMGCRTVEQREKIKEKINKAGKHLVVEEVKNKDPMLVLRGVLSVHTDEDILEALKNQNGDVFRGLSDGEARVGVKFRRRARNPHTNHIVLTASPVVWRRALEKSRLWVDMQAVPVEDQSPLVQCTRCLGYGHGRRFCKEAVDICCHCGGPHLRAECPHWLAAEEPQCRNCVLAKMAHCVMPTERTPHRILQANLQRQKLATTELMLEATKRQAIAALLQEPYVGGNKSMSGVRGVRVFQNTRIEEGTVKAAIAVFDANISVIQYPELTTNNIVVVGIRTGTWEITLASLYFEPDKPIEPFLDHLRKVGKATNIIIGGDVNARSVWWGGPSTNSRGEALLGALDELGLHVLNQGEIPTFDVIRGERHLTSYVDITACSPDVLGLVDDWRVLEDLTSSDHNGIEFKINLHKSKGHTVHRTTRIYNTKKANWAQFRVKLGELLLSTTLNRDAINNINTIQEIEQITVTYTNTITNACTHTIPQKKNLEKFSVPWWSEELAGLKRRVVTRKRRIRCAALVRRPRVVQEYLEERAKYRAAIKEAQIASWKGFCERQDREGMWEGIYRVIGRVSRREEDIPMEREGIVLDADSSATYLAETFYPEDLTDLDDPGHGETRRRAAELDSDSGGARDPPFTMHELDRSVRSFNPKKAPGADGLTADICKEAVNSDPELFLALVNKCLELRYFPKVWKAATVIILRKPGKNNYATPKAHRPIGLLPVLGKVYEKMIVARLKYHILPSMSAHQYGFMPQRSTEDALYTLLERIREKLLDKKLILMVSLDIEGAFDSAWWPAIKVRLVEESCPVGIRGVMNSYMSDRTVGVRYMGAEHLRATGKGCVQGSIGGPILWNLLLDPLLKGLSTRGDYVQAFADDVVLLFDGDTAMDVQRRANAALEYVRAWGVMNKLKFAPHKTCAMVITRKLKHDTPRLSMGGVDIGMSKEVLLLGLTIDHKLTFNTHVANVCAKAANLYKRLTRAAKVGWGLHPEVIKTIYIAVVEPVILYASSAWAPAANKLGVRKRLNAVQRSFAQKLCRAYRTVSLNSALVLAGVLPLDLRVREMASLYVAKRGAHLPVLGDRDIERVASALERPHPAEQVGMELRSLVDEEQYLEHRGYEVRIFTDGSKIEGKVGAALSIWTGEAEAKTLKLALSPHCTVYQAELLALCEAANEISRRKENVFAIFSDSMAALQTVADPDSLHVLAVRMRGALSHCKTQGKSVSLFWIKAHAGLEGNERADALAKAAALRLKKKPNYDRCPVSFAKRVIRMDTLAEWDRRYSAEQTASVTKLYFPIASEAYRIIRNIEMTKEVAQAFTGHGGFSEYLARFKCKESPACICDPYVDESVAHVLLECPVFGSARFDLEVELGQRLHARKLPNLMKKTCARNLFLKYAIKIIKEVNKRNRT

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00075   RNase_H
PF00078   RVT_1
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF52540   SSF52540       
Gene 3D
PDB
1WDU     E-value=5.34824e-74,     Score=712

Ontologies

Topology

Length:
1698
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.477100000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1698
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.05905
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号