SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04983
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.412 Peroxisomal   Reliability : 1.141
 

Sequence

CDS
ATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGGGAGGGCCGCTCTACGATCGACGCGATTCTGCGCGTGAGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATACGGGGTCCCCTCCCCGGACTGAGCGTCATTTGCTACGCTGACGACACTCTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACTGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGATTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTATTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCATCACTGCGCGGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGTGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGGCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPCVVATMLGSDASWKAMLDFCEATISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    AB078935    BAC06462.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    RSAL01000481    RVE41577.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    RSAL01003504    RVE40273.1    LBMM01006063    KMQ90967.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01005733    KMQ91252.1    LBMM01005948    KMQ91066.1    LBMM01015018    KMQ84954.1    LBMM01003575    KMQ93366.1    LBMM01002052    KMQ95336.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    LBMM01019839    KMQ83438.1    LBMM01003245    KMQ93755.1    LBMM01003988    KMQ92922.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01019838    KMQ83439.1    LBMM01008682    KMQ88705.1    GGMR01000779    MBY13398.1    LBMM01006725    KMQ90373.1    LBMM01004505    KMQ92346.1    LBMM01008422    KMQ88894.1    KMQ94772.1    GGMR01014195    MBY26814.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01005465    KMQ91492.1    LBMM01014122    KMQ85315.1    ABLF02011238    GGMR01015159    MBY27778.1    LBMM01005474    KMQ91485.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    KU543683    AMS38371.1    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    LBMM01015285    KMQ84870.1    GGMR01004600    MBY17219.1    ABLF02014378    GAKP01002292    JAC56660.1    ABLF02023257    LBMM01014956    KMQ84982.1    LBMM01006977    KMQ90149.1    ABLF02011183    ABLF02041884    GFXV01002090    MBW13895.1    ABLF02059310    ABLF02041557    ABLF02014650    ABLF02018942    ABLF02041885    GGMR01011682    MBY24301.1    GALX01004785    JAB63681.1    ABLF02021100    KQ971309    EEZ99146.1    KQ972226    KYB24577.1    AJ278684    CAB99192.1    GGMR01015354    MBY27973.1    QOIP01000014    RLU15074.1    ABLF02009991    ABLF02009992    ABLF02054952    ABLF02018808    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GGMR01012748    MBY25367.1    GGMR01019493    MBY32112.1    LBMM01013668    KMQ85535.1    GGMR01009778    MBY22397.1    HACL01000281    CFW94575.1    GGFM01001554    MBW22305.1    GALA01001776    JAA93076.1    GGFJ01001165    MBW50306.1    AB593321    BAK38639.1    GALA01001777    JAA93075.1    GGFJ01001166    MBW50307.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF07776   zf-AD
PF00096   zf-C2H2
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
PF00151   Lipase
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021896   Transposase_37       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
IPR026960   RVT-Znf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=0.000169353,     Score=109

Ontologies

Topology

Subcellular location
Secreted  
Length:
623
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.26841
Exp number, first 60 AAs:
0.00197
Total prob of N-in:
0.00330
outside
1  -  623
 
 

Population Genetic Test Statistics

Pi
27.38645
Theta
3.255788
Tajima's D
-1.152152
CLR
0
CSRT
0.107144642767862
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号