SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04981
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.688
 

Sequence

CDS
ATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCAGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGATCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCTGCTCCACAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGATTGCGTTCGCGGCAGCAGAGGCCCGGCTGCACGGCGCATTCCGCGTCGCGCAGAAGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGCCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGTGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGCGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAAGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGCTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGATAGTCGTTGGACCTTCCGTGCTCACTTTCAGAGCCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGCTAAGCCGGCTTCTGCCCAACGTCGGGGGCCTGACCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGGGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGAGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGRIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSACSTVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPIAFAAAEARLHGAFRVAQKALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDAPPDYDGEAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEAAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIKRLGLDVALSKSEAMCFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQSLVPRLLGVAGALSRLLPNVGGLTSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKEMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078929    BAC06452.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    AB078936    BAC06464.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    AGBW02011529    OWR46521.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01004262    KMQ92649.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01015285    KMQ84870.1    LBMM01015025    KMQ84953.1    LBMM01006657    KMQ90417.1    LBMM01003988    KMQ92922.1    RSAL01003504    RVE40273.1    LBMM01009535    KMQ88053.1    LBMM01012412    KMQ86235.1    LBMM01006996    KMQ90130.1    LBMM01008422    KMQ88894.1    LBMM01014122    KMQ85315.1    LBMM01008445    KMQ88871.1    LBMM01008278    KMQ89009.1    LBMM01005474    KMQ91485.1    LBMM01009610    KMQ87992.1    LBMM01007425    KMQ89740.1    LBMM01006977    KMQ90149.1    GGMR01015159    MBY27778.1    ABLF02034925    GGMR01006838    MBY19457.1    ABLF02018098    ABLF02011238    ABLF02030663    ABLF02041312    LBMM01003941    KMQ92970.1    LBMM01004261    KMQ92650.1    ABLF02013358    ABLF02013361    ABLF02054869    GBHO01006398    JAG37206.1    GBHO01002406    JAG41198.1    LBMM01005465    KMQ91492.1    GFXV01002090    MBW13895.1    ABLF02023257    ABLF02009073    ABLF02030702    ABLF02042963    GGMR01019493    MBY32112.1    GDAI01000741    JAI16862.1    GGMR01012748    MBY25367.1    ABLF02014650    GGFL01001916    MBW66094.1    ABLF02041557    ABLF02007989    ABLF02018758    ABLF02018759    GALA01001777    JAA93075.1    ABLF02027248    ABLF02018942    ABLF02041885    ABLF02011183    ABLF02041884    AB593327    BAK38648.1    AB593321    BAK38639.1    AB090815    BAC57906.1    GGFM01001733    MBW22484.1    GGFL01004044    MBW68222.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGFJ01001165    MBW50306.1    GGFJ01001439    MBW50580.1    GGFJ01001164    MBW50305.1    KQ971309    EEZ99146.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GGFL01001192    MBW65370.1    GGFM01001554    MBW22305.1    KQ972691    KXZ75806.1    KQ972544    KXZ75869.1    GGFK01007771    MBW41092.1    GGFJ01001369    MBW50510.1    ABLF02018808    GGFJ01001370    MBW50511.1    ABLF02041886    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF00098   zf-CCHC
PF01421   Reprolysin
PF00075   RNase_H
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR021896   Transposase_37       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=1.07401e-11,     Score=172

Ontologies

Topology

Length:
898
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.24799
Exp number, first 60 AAs:
1.17173
Total prob of N-in:
0.06077
outside
1  -  898
 
 

Population Genetic Test Statistics

Pi
152.980134
Theta
17.010258
Tajima's D
0.429366
CLR
0.368687
CSRT
0.502424878756062
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号