SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04962
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.338
 

Sequence

CDS
ATGCATCTACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCACTGCTGGGGACAAGGATGGCGCAGGCGATAGCGAACGAATTGGACATCGCGGCGGCAGAAGGACGTACTGGACTGACTCCAGTACAGTTCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTAGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGGAGCAGCAAGATCCCACGTGGAGGACGACGCGAGCGAAGCAGCCCCGATCAACATGGAAGATAAGGACTCCAGAAGCACCTACAGAAGCGTGGCTGCCACTCGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGGTGCGCCTTCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGAAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGGTGCGGCAGCGCTACTGGATCCTAGGTCTAAGATCGATCATTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGCCTACCGCCCACCGGAAACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCGATGACGGTGACTGTAGGACGACGTCACGAGAAGAGAACGAGCGGCGGCCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MHLREHLPRHASSRESQGDPTETSLYPKAGAASCTAGDKDGAGDSERIGHRGGRRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLEQQDPTWRTTRAKQPRSTWKIRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLVRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEVRQRYWILGLRSIIRATAVRCQWCKVYRSTPRLPPTGNLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRTSGGLLKRPASKMILLVPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
KQ459986    KPJ18861.1    RSAL01000375    RVE42106.1    LNIX01000004    OXA56382.1    GEBQ01015876    JAT24101.1    AAZX01023278    NWSH01008670    PCG62455.1    JXUM01151198    KQ571164    KXJ68235.1    RSAL01000010    RVE53755.1    JXUM01013493    KQ560378    KXJ82704.1    ODYU01003174    SOQ41584.1    LNIX01000039    OXA39294.1    LNIX01000019    OXA44812.1    DNYX01000180    HBK83090.1    JXUM01136032    KQ568367    KXJ69026.1    OXA44855.1    GAMC01020594    JAB85961.1    LNIX01000012    OXA48117.1    LNIX01000015    OXA46575.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    JXUM01146045    JXUM01146046    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    GGFL01001682    MBW65860.1    GGFL01001842    MBW66020.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGFJ01000306    MBW49447.1    GGFJ01000432    MBW49573.1    GGFJ01000487    MBW49628.1    GAMC01017930    JAB88625.1    GGFJ01000333    MBW49474.1    JXUM01031097    KQ560909    KXJ80382.1    GEHC01000913    JAV46732.1    JXUM01083542    KQ563383    KXJ73941.1    AB110069    BAD01590.1    BAD01589.1    GEHC01000967    JAV46678.1    GDHC01018323    JAQ00306.1    JXUM01111221    KQ565482    KXJ70922.1    GEZM01052586    JAV74401.1    GDIP01004568    JAM99147.1    GDIP01036233    JAM67482.1    GCES01110894    JAQ75428.1    GCES01103975    JAQ82347.1    JXUM01144298    KQ569759    KXJ68523.1    GCES01134385    JAQ51937.1    GCES01111900    JAQ74422.1    GCES01111762    JAQ74560.1    MRZV01000348    PIK51982.1    JXUM01020939    KQ560586    KXJ81781.1    GCES01112266    JAQ74056.1    GCES01132273    JAQ54049.1    GCES01140631    JAQ45691.1    GDIQ01002920    JAN91817.1    GBYX01150372    JAO92643.1    GCES01097166    JAQ89156.1    AAGJ04142769    AAGJ04142770    GCES01139493    JAQ46829.1    GCES01096787    JAQ89535.1    GGFK01006929    MBW40250.1    GDIQ01002921    JAN91816.1    GDIQ01143107    JAL08619.1    LSMT01000016    PFX33015.1    AAGJ04091218    AAGJ04001285    AAGJ04146728    AAGJ04146729    GCES01097275    JAQ89047.1    GEHC01000872    JAV46773.1    GEZM01052587    JAV74399.1    GCES01105349    JAQ80973.1    HAEJ01014775    SBS55232.1    NSIT01000285    PJE78034.1    AAGJ04024091    AAGJ04024092    AAGJ04024093    AAGJ04024094    AAGJ04024095    AAGJ04024096    AAGJ04095911    AAGJ04005692    NWSH01000532    PCG75836.1    GCES01114344    JAQ71978.1    LSMT01000326    PFX20202.1    GDIQ01114015    JAL37711.1    AAGJ04125735    GDRN01111556    JAI56762.1    GDRN01111557    JAI56761.1    GBYX01453073    JAO28442.1    GDIQ01071585    JAN23152.1    GDIQ01071584    JAN23153.1    GCES01096813    JAQ89509.1    GCES01130050    JAQ56272.1    RCHS01003537    RMX41025.1    GCES01130483    JAQ55839.1    GCES01095441    JAQ90881.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00069   Pkinase
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF00628   PHD
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR036305   RGS_sf       
IPR000961   AGC-kinase_C       
IPR000719   Prot_kinase_dom       
IPR000239   GPCR_kinase       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR016137   RGS       
IPR001878   Znf_CCHC       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR000477   RT_dom       
IPR001841   Znf_RING       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF56112   SSF56112       
SSF48097   SSF48097       
SSF57903   SSF57903       
SSF56176   SSF56176       
SSF55103   SSF55103       

Ontologies

Topology

Length:
458
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00172
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00248
outside
1  -  458
 
 

Population Genetic Test Statistics

Pi
181.48658
Theta
178.043087
Tajima's D
0.56413
CLR
0.231879
CSRT
0.538673066346683
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号