SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04938
Annotation
Transposon_Tf2-8_polyprotein_[Thelohanellus_kitauei]
Location in the cell
Nuclear   Reliability : 4.163
 

Sequence

CDS
ATGAACGATGAACAATTCGCATTATTTTTACATGCACAACAAAACCAGCAAGAGCAGATTTTACAAATCTTGAAATTGTTGGTACCAGCAGCTTGCAATACAACAGCCAAGAGCGTGACGAACGACTCTTTTACAAAACATGATACGGATAACAAGATAAGTATAATCAAACATTTCAATATGGATAAATACAATCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGGTATAGAGCCTTAACAGAATTTTGGAATTGCACTAGAGAACAAAATGAAACGATGGAACACTATGCAAACAGATTAAAAGGTCTTAGTCGGGATTGTGGCTACACTAATGACTTCCTGGAACGACAATTACGTGACCGCTTTGCCACTGGATTGAATCATCCAGATTTAGAAACCGACTTGAAACAAAAATGGCCTGATTTAGTTCAAATGGTAGACGGAATACCACGAGAAGTAACCTTCCAACAAATTTTTACAATCTCTCAATCAAGAGAACAGGCAGAACAAGACACACCACGAACAAGTATTAAAAAAATAAATAGGAGCATAACCAAAACTGTACCATTACATCAAAATACAACACGAAAATTAAATCCAATGCATTGTTTACGCTGTGGAAAGAAAGAACGGCACAGCCTATCACAGTGCTCAGCCAAGGACCATATGTGTAAAGAATGTAACACGAAAGCACACTTTGAGAGTTGTTGCATTAAGTCTGGACGGGCATACATCAGCTATTCAGAAGGGAGCCGAAAATCAATTAAAAAAATAACAAGACCTCATAAGTCCTCAACATCATCATCATCATCTATCAGTAATAACAAGGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGCATCAATGACATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTATGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAGGCCTACGGTAACACAAACTTAAAAACAAAGGGAATTACAAAAGTAACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAACACCGATGACTCTTAAACAAATATTGGATAAACATGTACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGTTAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAATTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCGATTTTCGATCAACTACGCCAAAATCTCGCAAACGGTAAATTATTTTCAAAAATAGACCTTAAAGACGCATACTTACAATTTGAAATAGCACCAGATTCGAAAAAGTACTTGACGTTGTCAACCCATAAAGGGTATTTCCAATACAATAGAATGCCTTTTGGAATATCGACTGCTCCTTCAATTTTTCAACATTTTCTGGATCAACTGCTAGGCGATATCACCAATGTAGCTGTATATTTTGACGACATAGCTATAGCAGGGAAAGATCTTTCAGAACATTTACAAACTTTATCTATTGTATTCGATCGCTTACAAAACGCTGGCCTAAAAGTTAATTTAAAGAAATGTAATTTCTTACAGAATCAGATTGAATACCTAGGTCACATAATAGATAAACATGGCATCCACCCAACCAAATCTAAAATTGATGCCATAACTAAGGCCCCAGCACCTAGTAATGCAAAAGAACTACGATCATTTTTAGGACTAGTTAACTTTTACGAACGGTTTGTACCACATCTTCACGGAATTTGTTCGGATCTTCATGATCTAACTAGTAAAAAAAATAGATGGCGTTGGACTGATCATGAAAACAGAATATTTGAAGATACAAAGAAATGCATAGCTTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAGCCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGTCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTTTCAGAACAGTTGCTTATGAAAACAACTTCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGATTACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATTAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTCTGTTTACATACAGAAACACTCCGCACTCATCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGGTTAATGCAGTATTTACAAGTAAAAGAAAATATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCTTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGACGACTGCTTCTCCAGACATTGGAATGGAAACATCAATTAGCGAAAGGCTAACTAACAATAAGAATTCGGCAGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAA
Protein
MNDEQFALFLHAQQNQQEQILQILKLLVPAACNTTAKSVTNDSFTKHDTDNKISIIKHFNMDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNKLLDLYRIKTTRYRALTEFWNCTREQNETMEHYANRLKGLSRDCGYTNDFLERQLRDRFATGLNHPDLETDLKQKWPDLVQMVDGIPREVTFQQIFTISQSREQAEQDTPRTSIKKINRSITKTVPLHQNTTRKLNPMHCLRCGKKERHSLSQCSAKDHMCKECNTKAHFESCCIKSGRAYISYSEGSRKSIKKITRPHKSSTSSSSSISNNKEESDDEVICSVLGTRKRECKQIDVRINDIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSTPMTLKQILDKHVQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIERELDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEIRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANGKLFSKIDLKDAYLQFEIAPDSKKYLTLSTHKGYFQYNRMPFGISTAPSIFQHFLDQLLGDITNVAVYFDDIAIAGKDLSEHLQTLSIVFDRLQNAGLKVNLKKCNFLQNQIEYLGHIIDKHGIHPTKSKIDAITKAPAPSNAKELRSFLGLVNFYERFVPHLHGICSDLHDLTSKKNRWRWTDHENRIFEDTKKCIASSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGARRNLPKLVNNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTSKDHILTKVCQNLKTGWRESDYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPTTASPDIGMETSISERLTNNKNSAAVAYKCTNFSKFTFTAFEVILLTCSGLHSCAICSASK

Summary

EMBL
GFTR01008725    JAW07701.1    GBHO01042596    JAG01008.1    GBHO01042589    JAG01015.1    + More
JWZT01002984    KII68048.1    JWZT01003820    KII65460.1    JWZT01000439    KII74358.1    EF199622    ABM90393.1    JYDL01000080    KRX17894.1    EF199621    ABM90392.1    HADX01010638    SBP32870.1    JYDO01000377    KRZ65389.1    GEFM01006397    JAP69399.1    HADW01008367    SBP09767.1    JWZT01003054    KII67871.1    JWZT01001161    KII72602.1    JWZT01005595    KII60489.1    JYDP01000327    KRZ01162.1    JYDJ01000151    KRX42156.1    JYDO01000093    KRZ71620.1    NIVC01001652    PAA65446.1    NIVC01001377    PAA68677.1    JYDJ01000764    KRX33566.1    JYDJ01000011    KRX49884.1    GEGO01002490    JAR92914.1    JYDH01000010    KRY40903.1    HAEH01013823    SBR98409.1    GEGO01004800    JAR90604.1    JYDW01000004    KRZ62956.1    KL363295    KFD48373.1    KL363215    KFD53596.1    JYDN01000036    KRX62850.1    KL367545    KFD65077.1    JYDP01000057    KRZ10689.1    JYDQ01000346    KRY08270.1    GEZM01043158    JAV79264.1    NIRI01001153    RJW67559.1    JYDL01000058    KRX19511.1    GEGO01004729    JAR90675.1    NIVC01001575    PAA66240.1    JYDQ01000124    KRY14116.1    JYDO01000236    KRZ66548.1    JYDN01000181    KRX54093.1    NIVC01000183    PAA88548.1    KL363640    KFD45214.1    GEZM01036245    JAV82862.1    NIVC01000860    PAA75827.1    KL363340    KFD47113.1    KL367859    KFD59517.1    GCES01009650    JAR76673.1    GEZM01050895    JAV75318.1    GGLE01005288    MBY09414.1    KL363314    KFD47775.1    GEGO01004533    JAR90871.1    JYDW01000348    KRZ48953.1    JYDP01000208    KRZ03007.1    JYDH01000411    KRY26494.1    JYDH01000399    KRY26536.1    KL363391    KFD46136.1    JYDH01000405    KRY26518.1    GEDV01006828    JAP81729.1    KL363264    KFD49780.1   
Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF00077   RVP
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR034128   K02A2.6-like       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=2.46626e-54,     Score=542

Ontologies

Topology

Length:
1396
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.58552
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00001
outside
1  -  1396
 
 

Population Genetic Test Statistics

Pi
361.716662
Theta
187.211418
Tajima's D
-1.076799
CLR
21.49119
CSRT
0.126543672816359
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号