SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04932
Pre Gene Modal
BGIBMGA007548
Annotation
PREDICTED:_uncharacterized_protein_LOC105841862_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.566
 

Sequence

CDS
ATGAGTGAGCCTTGTGATGGAGTTGGTGGCGTCAGTTTATCTGACGTCACCTTTTCCAAAAATTCTCCGGAGGTCGGTGCGCCGTCATCAGAAGTGGGATCACCTCCCACTTCTGCTCGCCCTTCTGGCTCGGTTAACAAAAATATGAACACTTCTGTTGATGGGGTGCCGGCTGATTTTTTCACTCAGATGTTGCAAATGATGAAACACGTGTCGGATCGTATGACGTCGCAATCAGATATTTCAAAAGTGAGAATAAATGACGTGTTTTTGCCGTCATACGATCCAGACGCTAATGTTGGGGTTAGAGAATGGTGTCAACATGTGACCACAGCTATGGAAACTTACAACCTGAGCGATTATGAAGTCCGGATGAAGGCTGGTAGTTTGCTTAAGGGTCGCGCAAGGTTGTGGGTTGACAATTGGCTGGTGTCCACCACCACGTGGCAAGAATTGCGTGATGTTTTAATTTCGACTTTTGAACCGGAAAACCGATATTCACGCGATGTTGTGCGTTTTAGAGAACATACTTACGATAATTCTAAAGACATCGCTCAGTTCTTATCACAAGCTTGGGTTTTATGGAGACGTATTACTAAAGATAAGTTGTCGAATGATGACGCGGTTGAGGCTGTTATCGGTTGCATTGGGGATGAGCGCCTGAGAATCGAATTGTTAAATGCGCGAGCTACATCTGTCCCAGAACTTATTTCAGTGGCCTCATCTATAAAAAGTGTTAAACGTCCTCATCCCAATGCATCGATACCGCATCAGAGTGTCGCAAAGCGCCCACGTTTTGATAAGACACCGGGCTTTTGCCAAATCTGTAAAAGGTCGGGTCACGATACGCGTGATTGCCGATACCGCGACAAACCTGAAGGCCCTCAGCCGCGACAACAGGATGGTAAAACTACTCCTCCAGGTGTTGGTAGACCGACATGTACGTTTTGTTCAAGGTTGGGTCATACTTATCAAACGTGTTACAAGCGAGAACGTGCAGTTGTTTCTAATGTCAATTGTGTGGGGACGTCAAAATTAAATGCGATGCCAGTTGTTGTAGGAGGTTTCAAAATAAATGCAATTTTTGATAGTGGAGCCGAATGTTCAGTCATTCGTGAATCTGTAGCTGCAAAGTTGCCGGGAAAACGCGTTGATAGGGGCTTATCCCATATTGAACGCATATTGATTGCTCTACAAGAAGCTGGCTTTTCTATTAACGTTGATAAAACCGCCTTCTTTAAACGCTCCATCGAGTACTTGGGCAATATAATTGCCGACGGGCAGGTTAGCCCTAGCCCAAGAAAGGTGGAGGCTTTAACGAAGGCACCAATCCCGAAAACTGTCAAACAAGTTAGACAATTCAATGGCCTGGCTGGATATTTCAGACGTTTCATTCCCAACTTCTCGCGAGTTATGGCGCCTTTATATGAACTCACTAAGAACGATACGACATGGGAATGGAACGAAAGGCATGACGAAGCTAGGGATTATATTGTCAAACATCTGTCTACTGCGCCTACCCTTACGCTATTCCAGGAAGACGCACCCATCGAACTCTACACGGACGCCAGCAGCATCGGCTACGGGGCAGTGTTAGTGCAGACATTCGCGGGTCGCCAACATCCAGTCGCGTACATGAGCCAGCGCACCACCGACGCCGAGAGCCGCTACCACTCTTACGAACTTGAAACGTTGGCGGTCGTAAGAGCAATTAAGCATTTTCGGCATTACCTCTACGGCCGAAAATTCAAGGTAATAACCGACTGTAATGCTCTCAAGGCCTCCAAAAACAAAAAGGACTTGCTTCCGCGTATCCATCGGTGGTGGGCGTTTTTGCAAAACTACGAATTCGAGGTGGAGTATAGGAAAGGTGAGCGATTACAGCACGCAGACTTTTTCAGTAGAAACCCTTGCAGCGAGATGTCAGTTAACGTTATGACTCGAGATATGGAATGGCTGCAGATTGAGCAGCACCGCGACGACGTGCTACGCCCAATGATGGAGAGTATAACATCTGGCGATTTCATCGAAGGCTATGTCATGGAAGATGGCATACTTAACAAAATGCTCACAGATCCTATACTCGGCATACATAAACCAATTGTAGTGCCTAAGTCTTTCCAGTGGAGCTTGATAAACTCCTTCCACGTGACACTGCAGCACCCAGGATGGGAGAAAACTCTGCAGAAGCTACGAGAAACGTACTGGTTTGACAAGATGAACTCGGCTGTTAGACGTTTTGTAGACCATTGTGTTATATGTAGAACCTCGAAAGGACCATCTGGTTCTATACAAGCGCAGCTCCATCCGATCCAGAAACCCACGGCAGCGTTCCAGGTCATTCATATGGACATCACAGGAAAATTGGGCACGAGAAACTCCGAAGGACAAGATGAGTACGTAATTGTTGCTATTGACGCATTCACGAAATACATATTACTGAGCTATTCCAATGACAAGAGCCCGAGCAGTACACTCGCGGCACTCAAGCGTGTCATTCACCTGTTTGGCACCCCGGTACAAGTGGTGGTTGATGGCGGTCGGGAGTTTCTCGGCGAGTTCAAAGTCTACACTGACCGCATAGGGATTGACGTGCATTCAACTGCGCCAGGAACAAGCCGAGCAAACGGACAGGTCGAAAGGGTCATGGGCACATTGAAAAATGCTCTTACCATGATCAAAAACTACAGTACTCAAGACTGGCAGACGGCGCTGGAAGCTTTACAGCTCGCTTTCAACTGCACGCCACATCGAGTGACAGGAGTAGCTCCGCTCACTCTCCTGACCCGCCGACAACATTGCATACCGCCAGAGTTACTAAGGTTGGTGAATATTGAGAACGAATGCATAGATTTTGATCTGCTCGAGCAACACGTACGACAGAAAATGATTGATGCGGCGCAATACAACAAGCAACGCTTCGACAGAGGCAAGGCGAAATTGCGCCCATTTCAACGAGGTGACTACGTACTCGTCAAGAACAATCCTCGTAACCAGACATCCCTCGACCTCAAATACAGTGAGCCGTATGAAGTATGCAGAATCCTGGACAACGATCGGTACATCATCAAGCGAGTGACCGGCAGAGGGCGCCCTCGTAAAGTCGCCCACGACCAGTTGCGCCGAGCGCCCCAGCCCGGCGAGCAGGACACCGTGTCGACGGACAGTGTAGAGGACCCCGAGCGACAACCGGCGAGCGTGCCGGCCGACGAGACTGAAACAGATGCCACATCTCGGCCCCAGCCCCTGCCGTCTACCTCGCGAGCTGCCCAGGCCTTGGATGCTTAA
Protein
MSEPCDGVGGVSLSDVTFSKNSPEVGAPSSEVGSPPTSARPSGSVNKNMNTSVDGVPADFFTQMLQMMKHVSDRMTSQSDISKVRINDVFLPSYDPDANVGVREWCQHVTTAMETYNLSDYEVRMKAGSLLKGRARLWVDNWLVSTTTWQELRDVLISTFEPENRYSRDVVRFREHTYDNSKDIAQFLSQAWVLWRRITKDKLSNDDAVEAVIGCIGDERLRIELLNARATSVPELISVASSIKSVKRPHPNASIPHQSVAKRPRFDKTPGFCQICKRSGHDTRDCRYRDKPEGPQPRQQDGKTTPPGVGRPTCTFCSRLGHTYQTCYKRERAVVSNVNCVGTSKLNAMPVVVGGFKINAIFDSGAECSVIRESVAAKLPGKRVDRGLSHIERILIALQEAGFSINVDKTAFFKRSIEYLGNIIADGQVSPSPRKVEALTKAPIPKTVKQVRQFNGLAGYFRRFIPNFSRVMAPLYELTKNDTTWEWNERHDEARDYIVKHLSTAPTLTLFQEDAPIELYTDASSIGYGAVLVQTFAGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAIKHFRHYLYGRKFKVITDCNALKASKNKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHADFFSRNPCSEMSVNVMTRDMEWLQIEQHRDDVLRPMMESITSGDFIEGYVMEDGILNKMLTDPILGIHKPIVVPKSFQWSLINSFHVTLQHPGWEKTLQKLRETYWFDKMNSAVRRFVDHCVICRTSKGPSGSIQAQLHPIQKPTAAFQVIHMDITGKLGTRNSEGQDEYVIVAIDAFTKYILLSYSNDKSPSSTLAALKRVIHLFGTPVQVVVDGGREFLGEFKVYTDRIGIDVHSTAPGTSRANGQVERVMGTLKNALTMIKNYSTQDWQTALEALQLAFNCTPHRVTGVAPLTLLTRRQHCIPPELLRLVNIENECIDFDLLEQHVRQKMIDAAQYNKQRFDRGKAKLRPFQRGDYVLVKNNPRNQTSLDLKYSEPYEVCRILDNDRYIIKRVTGRGRPRKVAHDQLRRAPQPGEQDTVSTDSVEDPERQPASVPADETETDATSRPQPLPSTSRAAQALDA

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=5.56424e-33,     Score=357

Ontologies

Topology

Length:
1095
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00186
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  1095
 
 

Population Genetic Test Statistics

Pi
25.188676
Theta
23.874989
Tajima's D
0.168375
CLR
17.760757
CSRT
0.424678766061697
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号