SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04926
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Nuclear   Reliability : 2.981
 

Sequence

CDS
ATGCCGATAACGCGGTCAACAGGAAGAGGACGGATCGAAACTAAACAATCGCCGCCCTCAGAAACCACAGCTACAACACAGAGCATGTGGACAGAAACAACCGCGAATACCGTCATGAGTCTGGTAGCCCCCACAACAGAATCATCGTGCGCAACAGCCAACACGGAAGCCACGACGAAACTCGCAGAGAAACCTGGGAACTCAAAAACAGAGGCCGTCAAACAGTATATAGTCAAACAGAATGACGTGCCAACAAAACAGCGCGCCGGTACAGTCAAAACTGACCGGTCGCGATACAGAAAAGAACAGAAGATAGCCAAAGCTAGAGAAGAGCTCGCCCGCCTACAGGTGGAATTGGCAGCCGCCCGACTGGCCACGCTCGAAGCCGGATCTGACGACGAAAACAGTGAATTAGAATACAGTCCCGACAACGTGGGGCGCATCGTAGACATCAGAACCAAGGGTGGAGTTCTACGAAGACCAGTACGAAAACTACTGATCCTGCCCATCGAAGAAGACCATCCTGCACCGAGAAGAATGCGACGGACTCGCACGGCGGGAGTAATGTGCAGGACGAAATAG
Protein
MPITRSTGRGRIETKQSPPSETTATTQSMWTETTANTVMSLVAPTTESSCATANTEATTKLAEKPGNSKTEAVKQYIVKQNDVPTKQRAGTVKTDRSRYRKEQKIAKAREELARLQVELAAARLATLEAGSDDENSELEYSPDNVGRIVDIRTKGGVLRRPVRKLLILPIEEDHPAPRRMRRTRTAGVMCRTK

Summary

Uniprot
Pfam
PF03564   DUF1759
Interpro
IPR005312   DUF1759       
ProteinModelPortal

Ontologies

Topology

Length:
193
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00034
Exp number, first 60 AAs:
0.00034
Total prob of N-in:
0.20912
outside
1  -  193
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.145461
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号