SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04923
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Location in the cell
Mitochondrial   Reliability : 1.607 Nuclear   Reliability : 1.818
 

Sequence

CDS
ATGATGGCGAGCACCGCACTGTCCCTTATGGGACGGTGTAACCCGGATGGCTGTACACGTGGTAAACACGTGACAGCAGCCCCGATGGACGGACCGCGAGGACCGTCAAGCCTAGCAGGTACCTTCGGGTGGGGCCTTGCGATACCTGCGGGCGAACCCTGTGGTCGGGTTTGCAGCCCGGCCACAGTGGGTTTTTTTCCTGTTGCAAAAAAGTCAAATAAAGAAAATAGACCTGAAGCCTCTGGCCTCCCGCTGGAGTCAGAGAGGACAGGCGATAACCCGACTGTGCGGGGTTCCGCCGGCGCAGATCCTGTGGGTCAGGATGCGCCTGGTTGGACCTGCCAGTTCTGCGAACGAACCTTTTCGACCAACAGGGGTTTGGGTGTCCACAAGCGTAGAGCCCACCCTGTTGAGACCAATACGGATGCCGCTCCGATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAATCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCGGGGGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGAAGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGATGATCGGACAGCTAGTGCCCACAAAACCAGTAGACAAAAGCGCAGGGCAGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGATGCACCTGGGCCTACACCGGAAGCTCTTCACGCCCTAGGGCGTGCGGAGTGGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGGTCAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTACCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGATGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACAGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTAAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTCGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAAAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGATTCCAGCACGGTTTTGTGCTTGGAAACATCTCGGATGACCGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTAAGGCTACCGGCGGATGTGCCCAAGGCATATTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTAAGAAACTGCGGTGGGCCTGGAAACAGCTCCGCAGGTTCAGCCGTGTTGACTCCACAACGCAACGACCATCTGTGCGCTTGTTTTGGCGAGAACATCTGCATGCATCTGTTGATGGACGCGAACTTCGCGAATCCACACGCACCCCGACATCCACAAATCCATATTGA
Protein
MMASTALSLMGRCNPDGCTRGKHVTAAPMDGPRGPSSLAGTFGWGLAIPAGEPCGRVCSPATVGFFPVAKKSNKENRPEASGLPLESERTGDNPTVRGSAGADPVGQDAPGWTCQFCERTFSTNRGLGVHKRRAHPVETNTDAAPMMVKRRWHGEEIDLLARTEARLLAERGQCSGGDLFGALPGFGRTLEAIKGQRRREPYRALVQAHLARFGSQPGPSSGGCSAEPDFRRASGAEEAGEERCAEDAAAYDPSAVGQMSPDAARVLSELLEGAGRRRACRAMRPKTAGRRNDLHDDRTASAHKTSRQKRRAEYARVQELYKKCRSRAAAEVIDGACGGVGHSLEEMETYWRPILERVSDAPGPTPEALHALGRAEWHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSGQWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARAAAKSDKIRKKLRWAWKQLRRFSRVDSTTQRPSVRLFWREHLHASVDGRELRESTRTPTSTNPY

Summary

Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
PDB
6AR3     E-value=0.079713,     Score=87

Ontologies

Topology

Length:
891
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00204
Exp number, first 60 AAs:
0.00066
Total prob of N-in:
0.00005
outside
1  -  891
 
 

Population Genetic Test Statistics

Pi
138.26538
Theta
135.09931
Tajima's D
0.633329
CLR
0.372989
CSRT
0.557022148892555
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号