SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04912
Pre Gene Modal
BGIBMGA008012
Annotation
PREDICTED:_tigger_transposable_element-derived_protein_4-like_[Papilio_machaon]
Full name
Tigger transposable element-derived protein 4      
Location in the cell
Nuclear   Reliability : 3.353
 

Sequence

CDS
ATGTCACAAAGAAAAAGAAAACAAATTAATATTGAGGAAAAATCGCGTATTATAACCAAGCTAGAGAGCGGAATTTCAAACAAAGACTTAGCAAAGGAATATGGTGTATCACACTCGACAATTTCAACCATTTGGAAAGAGCGAGAAAAAATTCAAACGCTTTATGACAATAATTTTTTGAAAATGAAGCGAGCCAGAACAACGAAGCATACGAATATTGAGGAAGCTTTGTTAAAGTGGTTTAAATATCAAAGGGCTAATAATGTGCCAATAAACGGACCGATTCTTCAACAAAAAGCTAACGATTTTGCTCAATGTTTTGGCGAAGATTTTGTTTGCTCGTCTAGTTGGATTCAACGTTTCCGGGCTCGGCACGGTATTGTCGGCGGGAAAATGAGTGGTGAAGCTGCTAGTGTTGATAAGGATACTGTAGAAGAATGGATGAAGCAAAAGTGGCCTACATTATTCGAAGGCTACGGACCAGATGAAATTTTTAACGCAGATGAAACTGGACTTTTTTACAATATGACACCAGACAAGACTTTAAAGTTCAAAGGAGAGAATTGTTTGGGAGGAAAAATGTCTAAAACGAGATTAACGATCATGGTTGCAGCAAATATGACAGGATCCTGTAAAAGAAAGCTTTTAGTTATTGGCAAATCTAAGAAACCAAGATGCTTTAACATACACTCACTGCCGGTAACGTATGAAAACAATGTGAAGTCATGGATGACATCGGACATTTTTGAGAGATGGTTAAGAAACTGGGACGCTGAATTGAAGGGAAACAAACAGAAAGTTCTACTTTTGGTTGATAACTGTCCTGCTCATTCAGCTGTTACTAATCTAAAATGCATTAAACTTGTGTTCTTACCACCAAATGTTACATCTGTATTGCAACAAGGTGTAATAAGGTGTTTAAAATCTCACTATAGAAGACTGCAAGTGTTAAAGTTATTACAAAACCTTGACAGTAGCGACCAAAAAAGCTTTACGGTTCTTGATGCCATCTTGATGATATCAGAAGCATGGGAAAACGTTTCACAAAACACTATAGCTAACTGCTTTAAGCATGCTGGTTTTAAAGACCTCTTAACAATAACCTCAGATGATGTGACTGATGATGATGGAGAGGACAATATTTCTGTTGCTCAATTAGCCCAAAATTTACGACCTGCTTTATCTATTACTGAAGCAGCAGAGTTCATTGATGTAGATAACTCTATTGCAATTTGCGCACGAGCTACAGAAGATGATATTATACGAAATGTTAAAGAAGAAGATGACGAACAGGAAGACTCTGAAGAACAATTTACTGTACCAACTTTGAATGATGGTATCAATGCTGTTAGTGTATTAAGAAAGATTGTTCTTTTTAATGAACACATCCACAGCAATTATGACGATACGTTAATTAAAATCCAACGTGAATTACAAAATATCTATGCACAGCAGAAGTGTTCCAAACAGACCAAAATTGCAGATTTTATGCTCACAGAAAAATAG
Protein
MSQRKRKQINIEEKSRIITKLESGISNKDLAKEYGVSHSTISTIWKEREKIQTLYDNNFLKMKRARTTKHTNIEEALLKWFKYQRANNVPINGPILQQKANDFAQCFGEDFVCSSSWIQRFRARHGIVGGKMSGEAASVDKDTVEEWMKQKWPTLFEGYGPDEIFNADETGLFYNMTPDKTLKFKGENCLGGKMSKTRLTIMVAANMTGSCKRKLLVIGKSKKPRCFNIHSLPVTYENNVKSWMTSDIFERWLRNWDAELKGNKQKVLLLVDNCPAHSAVTNLKCIKLVFLPPNVTSVLQQGVIRCLKSHYRRLQVLKLLQNLDSSDQKSFTVLDAILMISEAWENVSQNTIANCFKHAGFKDLLTITSDDVTDDDGEDNISVAQLAQNLRPALSITEAAEFIDVDNSIAICARATEDDIIRNVKEEDDEQEDSEEQFTVPTLNDGINAVSVLRKIVLFNEHIHSNYDDTLIKIQRELQNIYAQQKCSKQTKIADFMLTEK

Summary

Similarity
Belongs to the tigger transposable element derived protein family.
Keywords
Complete proteome   DNA-binding   Nucleus   Reference proteome   Polymorphism  
Feature
chain  Tigger transposable element-derived protein 4
sequence variant  In dbSNP:rs34432931.
EMBL
BABH01023425    BABH01031799    ODYU01005364    SOQ46128.1    GALX01001744    JAB66722.1    + More
GGMR01015638    MBY28257.1    CH933812    KRG07157.1    GEZM01080219    GEZM01080218    JAV62288.1    GEDC01028852    JAS08446.1    GEDC01014329    JAS22969.1    GGMR01008478    MBY21097.1    GGLE01001733    MBY05859.1    GFAA01002355    JAU01080.1    GFAA01000830    JAU02605.1    ABLF02034653    GACK01004010    JAA61024.1    ODYU01006373    SOQ48166.1    GFAC01005544    JAT93644.1    ABLF02022231    KK492952    KFQ64083.1    GACK01000229    JAA64805.1    AKHW03000533    KYO46313.1    GACK01000230    JAA64804.1    KL483028    KFO08644.1    KL206458    KFV82448.1    AAEX03010049    AAQR03075137    GFAC01005197    JAT93991.1    HAAF01000614    CCP72440.1    GFAC01004569    JAT94619.1    AGTP01094548    KL225334    KFW71199.1    GEFH01002147    JAP66434.1    LJIJ01003184    ODM88784.1    GBBM01000897    JAC34521.1    GL192370    EFB26546.1    KB017510    EPY77151.1    ACTA01040196    IAAA01026926    LAA07859.1    GACK01003875    JAA61159.1    AK081667    GEBF01002134    JAO01499.1    AEYP01045400    GFAC01005547    JAT93641.1    KL884776    KGM00171.1    GGMS01000470    MBY69673.1    HACG01049168    HACG01049169    HACG01049170    HACG01049171    CEK96033.1    CEK96034.1    CEK96035.1    CEK96036.1    JH882892    ELR47958.1    CYRY02045419    VCX40834.1    GFAC01005556    JAT93632.1    GFPF01012384    MAA23530.1    AC106882    BC037869    AK058054    KK670541    KFQ04678.1    GEGO01004586    JAR90818.1    GGLE01002517    MBY06643.1    AANG04001605    KK450013    KFQ73044.1    KU056810    AOE48154.1    AEFK01215205    KL217999    KFP00837.1    KZ505784    PKU45052.1    KL466368    KFV16805.1    GEFH01000749    JAP67832.1    KK118338    KFM72755.1    AQIB01017567    KL384076    KFP89305.1    CABD030034291    AACZ04005051    GACK01000074    JAA64960.1    AHZZ02028028    KK120216    KFM77786.1    AMGL01037157    ADFV01178485    AQIA01056733    CM001280    EHH54020.1   
Pfam
PF03221   HTH_Tnp_Tc5        + More
PF03184   DDE_1
PF04218   CENP-B_N
PF01388   ARID
PF08449   UAA
PF09026   CENP-B_dimeris
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR036431   ARID_dom_sf       
IPR001606   ARID_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR011991   ArsR-like_HTH       
IPR013657   UAA       
IPR015115   CenpB_C       
IPR033062   CENP-B       
SUPFAM
SSF46689   SSF46689        + More
SSF46774   SSF46774       
Gene 3D
PDB
1HLV     E-value=1.15631e-11,     Score=170

Ontologies

Topology

Subcellular location
Nucleus  
Length:
501
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00859
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03696
outside
1  -  501
 
 

Population Genetic Test Statistics

Pi
227.143488
Theta
174.496452
Tajima's D
1.107263
CLR
0.404399
CSRT
0.690615469226539
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号