SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04884
Pre Gene Modal
BGIBMGA008019
Annotation
AF173553_1_V-ATPase_110_kDa_integral_membrane_subunit_[Manduca_sexta]
Full name
V-type proton ATPase subunit a      
Location in the cell
PlasmaMembrane   Reliability : 4.866
 

Sequence

CDS
ATGGGCTCCATGTTCAGGAGCGAGGAGATGGTCCTCTGTCAGCTCTTCGTTCAGCCGGAGGCGGCTTACGTCTCCATGTACGAGCTAGGAGAAGCTGGTATTGCTCAATTCCGAGATTTGAATCCACACGTAAATGACTTCCAAAGAAGATACGTAAGTGAAGTTCGCCGCTGCAGCGAGATGGAACGCAAGCTGCGATGGGTGAGTGGAGAGCTACCGGAGCCTCCTCCTCCGCCCATACCCTCGCGACGGATGCTCAGTCCACGAGAGATCAATATGCTAGAGGAAAAAATTGATTACATCGAATCAGAAATCCAAGAGATGACAAAAAACGCTCGAAACCTCAAAAGCGACTACCTTTCCTTGATAGAGCTGAAACTTCTCATAGAGAAAACACAGACCTTCTTCCAAGATCACAGCGCCCAGAGGAAACTGTCGGCCACCGTTCAGATCTACAACAATGACGCTGTTTTCGGGCACCTCGGCTTCATCGCGGGAACAGTGGCCACATCCAGGGTGCCTTCGTTTGAAAGGATGCTATGGAGGATATCGCACGGGAACATATTCTTCAAACAGGCACAGATCGATCAGCCTCTAAAAGATCCCATTACGGGTCACGAACTACAAAAGACTGTCTTCGTAGTATTCTTCCACGGTGAGCAGATCAAGTTGAGAGTGAAGAAGGTCTGCTTTGGGTTTAAAGCTACTCTGTACCCATGCCCTGCGACGTATAAGGACCAGCAAGAAATGCTGTCTGGAGTCGAAACGAGGATCAAGGACTTAGAAATGGTACTAGACCAGACAGAGCAGCACAGACGATTGGTCCTCACCAATATAGCAGGAGACATCAGCACGTGGATGCTGGCCGTAAGGAAGGAGAAGGCCATCTACCATACCCTCAACATGTTCAGCATGGACATCATTAAGAAATGCCTCATCGCTGAATGCTGGGTTCCAAAAAGTGATCTTTACATTGCCCAGAAGGCTCTGGATGATGGAGTGAAAGCAAGTGGCAGTCCCATTCCATCCATCCTCCACCACGTGCCAACCAGAGAAATACCACCCACTTTTAACAGAACCAACAAATTCACGAGGGGATTTCAAACTCTTATTGATTCCTATGGAATCGCCAGCTACAGAGAAGTAAATCCAGCGCTATACACAATCATAACATTCCCGTTTCTGTTCGCCGTCATGTTCGGCGACGTAGGCCATGGACTTATCATGACTGCCTTTTCTGCGATCATCGTTATATACGAGAAGAGACTCTCGAAGAATAAATCGGACAACGAAATATGGAACATTTTCTTTGCCGGACGATACATTATCTTACTGATGGGAATATTCTCTGTCTATACCGGTTTGATCTACAACGACATGTTCTCGAAGTCTCTGAATCTGTTCGGAAGTAGTTGGATGAACGTTTACGATAGTGAAACCCTTGCGAATCATACATCGTTGGAATTGGATCCGGCTGTGGCCTACACTCAAACGCCATATCCTTTCGGCTTGGACCCGGCGTGGCAGTTCGCCACGAACAACATAATATTTTTGAATTCATTCAAAATGAAACTGTCCATTATATTCGGCGTACTGCACATGGCGTTCGGTGTGACAATGAGTGTGGTAAACTTCAATTTCTTCAGGAAGCCGGAAATGATTTATCTCCAGTACGTGCCGCAAATTCTGTTTCTGATGCTGCTGTTCTGGTACCTCTGTATATTGATGTTCATGAAGTGGACCATGTACTCCGCCACGGCGACAGACCCGACATACGGTACGTCTTGTGCCCCATCAGTCCTAATAACCTTCATCAACATGATGCTGCTGAAGGGCTCTGAGGACAGCCCTCCGTGTAAGGCGATGATGTTCGACGGCCAGGACGCATTGCAGAAGTTATTCTTGACGCTTGGCTTCCTTTGCATTCCGATAATGTTATTCGGGAAACCGGCATTCTTGTTCTGGCAAGCCCGTAACCGGAAGCGCCACGAGGTGGGCGGGGAGCGCGGGGAGGTGCCGGCGGGGGCCGGCGGGGGTGCGGGGGCGGCGGGGGAGCTGCTGATCACGCAGGCGATACACACCATAGAGTACGTGCTGGGCACCGTCTCGCACACCGCCTCCTACCTGCGCCTCTGGGCCCTCTCCCTCGCGCACGCACAGCTGTCGGCCGTGCTGTGGCAGCGCGTGCTCCGCTACGGCCTGGCCAGGAGTCTGGCGGGCTCCGTCACCATGTACGTGGGGTTCGCGGTGTGGGCCTTCTTCACGCTCGCCATCCTCGTCCTCATGGAAGGACTGTCTGCCTTCCTGCACACGCTGCGGTTGCACTGGGTCGAGTTCATGAGTAAGTTCTACGACGGACAAGGATACGCTTTCATGCCGTTCTCATTCGCGGCCATCATAGAGCACGACGACGAGGAACTGGCGCAAAATGGCGCGCCGCCCGAGAAGAAAGACGAAGAATATTAA
Protein
MGSMFRSEEMVLCQLFVQPEAAYVSMYELGEAGIAQFRDLNPHVNDFQRRYVSEVRRCSEMERKLRWVSGELPEPPPPPIPSRRMLSPREINMLEEKIDYIESEIQEMTKNARNLKSDYLSLIELKLLIEKTQTFFQDHSAQRKLSATVQIYNNDAVFGHLGFIAGTVATSRVPSFERMLWRISHGNIFFKQAQIDQPLKDPITGHELQKTVFVVFFHGEQIKLRVKKVCFGFKATLYPCPATYKDQQEMLSGVETRIKDLEMVLDQTEQHRRLVLTNIAGDISTWMLAVRKEKAIYHTLNMFSMDIIKKCLIAECWVPKSDLYIAQKALDDGVKASGSPIPSILHHVPTREIPPTFNRTNKFTRGFQTLIDSYGIASYREVNPALYTIITFPFLFAVMFGDVGHGLIMTAFSAIIVIYEKRLSKNKSDNEIWNIFFAGRYIILLMGIFSVYTGLIYNDMFSKSLNLFGSSWMNVYDSETLANHTSLELDPAVAYTQTPYPFGLDPAWQFATNNIIFLNSFKMKLSIIFGVLHMAFGVTMSVVNFNFFRKPEMIYLQYVPQILFLMLLFWYLCILMFMKWTMYSATATDPTYGTSCAPSVLITFINMMLLKGSEDSPPCKAMMFDGQDALQKLFLTLGFLCIPIMLFGKPAFLFWQARNRKRHEVGGERGEVPAGAGGGAGAAGELLITQAIHTIEYVLGTVSHTASYLRLWALSLAHAQLSAVLWQRVLRYGLARSLAGSVTMYVGFAVWAFFTLAILVLMEGLSAFLHTLRLHWVEFMSKFYDGQGYAFMPFSFAAIIEHDDEELAQNGAPPEKKDEEY

Summary

Description
Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes. Required for assembly and activity of the V-ATPase.
Similarity
Belongs to the V-ATPase 116 kDa subunit family.
EMBL
AF173553    AAF28474.1    AGBW02015053    OWR40651.1    KZ149969    PZC76113.1    + More
KQ459185    KPJ03378.1    KQ461198    KPJ05979.1    ODYU01006919    SOQ49194.1    KQ459220    KPJ02860.1    BABH01010757    BABH01010758    BABH01010759    GDQN01008557    GDQN01001991    JAT82497.1    JAT89063.1    KQ459984    KPJ18978.1    KU550964    ANW09710.1    AGBW02012778    OWR44452.1    GFDL01009700    JAV25345.1    CM000364    EDX12446.1    GANO01000631    JAB59240.1    NEVH01002707    PNF41457.1    GFXV01004235    MBW16040.1    AXCN02000267    AXCM01006747    CH480820    EDW54647.1    GGFK01001212    MBW34533.1    GGFK01001312    MBW34633.1    AF132183    AE014297    AAD34771.1    AAF55552.2    CM000160    EDW95904.1    CH902617    EDV42677.1    KPU79847.1    APCN01000888    AAAB01008987    EAA43151.2    OUUW01000013    SPP88009.1    ADMH02001150    ETN63909.1    GGFJ01002077    MBW51218.1    JXUM01123189    JXUM01123190    JXUM01123191    JXUM01123192    GAPW01000216    JAC13382.1    CH940652    EDW59356.1    KRF78813.1    CM000070    EAL27684.1    GFDF01009183    JAV04901.1    GGFM01000600    MBW21351.1    CH479179    EDW24803.1    CH478180    EAT33671.1    GEBQ01024009    GEBQ01003411    JAT15968.1    JAT36566.1    GFDF01009184    JAV04900.1    GGFM01000527    MBW21278.1    KK852470    KDR23260.1    CP012526    ALC46094.1    GEBQ01009678    GEBQ01002003    JAT30299.1    JAT37974.1    CH933806    EDW14441.1    KRG01017.1    AJ439060    CAD27758.1    KA646853    AFP61482.1    KQ977935    KYM98717.1    CH964232    EDW80572.1    GDAI01000904    JAI16699.1    KQ971311    EEZ99071.2    CH916369    EDV93299.1    GFDG01002069    JAV16730.1    GFDG01002067    JAV16732.1    CVRI01000006    CRK88011.1    GDHF01029529    GDHF01021876    JAI22785.1    JAI30438.1    KQ976467    KYM84195.1    GAKP01016222    JAC42730.1    UFQS01000635    UFQT01000635    SSX05612.1    SSX25971.1    SSX05611.1    SSX25970.1    GAMC01006625    JAB99930.1    DS234995    EEB10093.1    JXJN01015358    KB631625    ERL84786.1    APGK01052546    KB741213    ENN72620.1    AXCM01012792    JR053567    AEY61965.1    GBHO01001932    GDHC01015774    JAG41672.1    JAQ02855.1    GBXI01008638    JAD05654.1    KQ414710    KOC62988.1    KQ980713    KYN14244.1    AAZX01007551    GBHO01001936    GDHC01018959    JAG41668.1    JAP99669.1    GBRD01003998    JAG61823.1    GEZM01101879    JAV52239.1    GFTR01008140    JAW08286.1    GEZM01101880    GEZM01101878    JAV52238.1   
Pfam
PF01496   V_ATPase_I
Interpro
IPR002490   V-ATPase_116kDa_su        + More
IPR026028   V-type_ATPase_116kDa_su_euka       
PDB
6C6L     E-value=5.35497e-128,     Score=1175

Ontologies

Topology

Length:
821
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
144.13707
Exp number, first 60 AAs:
0.00137
Total prob of N-in:
0.01290
outside
1  -  396
TMhelix
397  -  419
inside
420  -  431
TMhelix
432  -  454
outside
455  -  525
TMhelix
526  -  548
inside
549  -  560
TMhelix
561  -  583
outside
584  -  632
TMhelix
633  -  655
inside
656  -  737
TMhelix
738  -  760
outside
761  -  821
 
 

Population Genetic Test Statistics

Pi
198.476418
Theta
161.034872
Tajima's D
0.767026
CLR
0.137366
CSRT
0.599570021498925
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号