SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04872
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.982
 

Sequence

CDS
ATGCCTCGGAAGGGTGCTAAAGAAGACGAAGAATGCTTTGCTGAACCTGCTCCACAAATTTCCTTCTGCGAATTAGAAAAATCTATGACTGCATTTTCTGGTGACGATGCATACGGCGTGGATACCTTTATAAAGGATTTTGAAGATATCGCTAATCTCATGCAATGGACGGGCATTGAAAAACTGATCTACGCAAAAAGGCTTTTGAAGGGGACAGCAAAACTGTTCCTGAGATCTTTGACTGGTACGACTACATGGGAACTCTTGAAAACGGGATTAAAAGAGGAATTTGGACTACATCTGAACAGCGCAGCCATTCACAAGACCATATCAAATAGGAAGATGAAACCAGGTGAAACCTACCGACAATATTTTTTGCAACTCAAAGAACTAGCAGTACTCGGAAATATTGAAGATGACGCCCTAATGGAATACATCATTGATGGCATCCCTGACAATGAAATGAATAAAACTATACTATATGGAGCTTCCAACATCAAAGAATTTAGGAAAAAACTTGATTTATATGCTGAAATAAAGAAGAAATGTCGAACGTCAAACAAAGCTTATAATCAATCAACAACATCCAAGCCTACAACATCTGGATGGAAGAAACCATTACCTAAGAAGAGATGTTTCAACTGCGGAGACCTAGATCATGAATCTTCAGGCTGCTCTAAAGGAATAAAGTGCTTCCGTTGTAATGACTTTGGTCATAAGTCAACTGACTGTCCCAAAAATATAAAGAAGACTCTAGAAATAAAATGTAACAAGGAGAATGATAGCCAAGCACCCTACAAAGAAGTTTTGATCAATAATGTTATGGTAAAATCACTTATTGACACTGGCAGTGATGTGAACCTAATGAATGAATCTACATTTACTCAAATACAAGGCGACACTTGTAACTACCACCCTGATTTAGTACAAAGCCTGACAGGCATTGGTGACTGTGAGGTACATACAAGAGGCTCATGTACTCCAAGAATTGAGATTGATGGTTGCCAATGTGAAGCAACGTTCTATATCATCGAAGATGACAAAATACCAGTTGATGTAATAATAGGGAACCCAATATTACAGGACATAGAACTCAGTTTTAAGTCTGGTGTTATTTCTGCTAAAAGAATTTTACAACTCACAATGTTAGAGGATCAGGCTGAGGAACCAATGATTATAGGAAATTTCAAATATAAAGATCAGATTGAGAAAATACTGACAGAATATGACCCTGGAAAATGTTCTAAAGAATCCAAAGTTGAATTAAAGTTATTACTTACTGATGAAACCCCAGTGTACCAGAATCCACGACGCCTATCCCCTTTAGAACTAGAAATTGTAGATAAACAAATTAAGGAATGGCTAAAGGATGGTATAATTAAACCAAGTAATTCAGACTTTGCAAGTCCAATAGTACTGGCAAAAAAGAAGAATAAAGGATATCGACTGTGTGTCGACTATCGAAAACTAAACAAAAAGATAATTAAAGAGAGATTTCCTCTTCCACTCATAGAAGACCAGATAGACAGGTTGAAAGACGCTACAATGTTTACAACATTGGACCTGAAAAATGGATTTTTTCATGTTAATGTTTGCAAGGAGAGCCAGAAGTATACATCGTTTGTGACTCCTCGTGCCCAATTCGAATTTCAAAAAATGCCTTTTGGTCTCTCCGTTGGACCCTCTGTGTTCCAGAGATTTGTTAATGATGTGTTTCAGGACCTGATCTTGGATGGTGTGGTGTTGACCTATTTAGATGATTTGATCCTGCCATTTAAACTTCCTAAAGAAGGTATTGAGAAGTTACAAAAAGTTTTATACAGAGCTGAAGAATATGGACTAACTTTCAACTGGAGTAAATGTCAATTTATGCAGAAGAAAATTAACTATTTGGGTTATATCATTGAGGATGGTAAAATCAGTCCATCAAAAGAGAAAGTGACTGCTGTTGCTCGTTTTCCAACCCCACACAATATTAAGACTTTACAATCATTTCTTGGACTTACAGGATATTTCAGAAAATTTATCAAAAATTATTCTCTTATAGCAAGACCGTTAACCAACCTTTTGAAAAATGGTGTTATTTTCAATTACGACGAAGAATGTGAGAAGGCAGTTGAGACCCTCAGAACTATTCTGTGTCAATCACCAGTTTTGCAGATCTACAATCAAGACTTAGAAACCGAACTCCACACTGATGCAAGTGCTGACGGCTATGGAGCTGTATTATTACAAAGAAACCTGAAAGATAATAAGATGCATCCAGTTTACTACATGAGTAGGAAGACTTCACCTGCAGAAAAGAAGTATCATAGTTACTATTTAGAAGTTTTAGCTGTTGTTGAAGCTATCAAGAAATTCAGAGTTTACCTGCTTGGAATCCATTTCAAAGTCATCACTGACTGCTCTGCTCTGACAACAACTCTAAAGAAAAAAGACTTACCTCCAAGAGTAGCACGCTGGGCTCTGTTGCTTGAAGAATATAATTACACTATTGAACATAGACCTGGAATAAGAATGAAGCATGCTGACGCTCTCAGTAGACAACCTGTAGAAAACATCTTTATACTTACCGACACAACCGCCCGCCTCCGTAGAGCACAAGATGATGACCTAAAAATAAAACTGATTAAAAAGGTCTTAGAAAAAGAACATTATGATGACTTTATGATTGAAGCTGGAATATTATGGAAAATAAAAGATGGAAAAAAATTAATGGTGGTACCTAAGAAAATACAAAATGAAATTATTAGAAAAAATCATGACAAGGGACATTTTGGATTAATTAAAACAGAAGAGTTGATTTCCAGAAACTATTACTTTGAAAACATGAAAGATAAGATCAAATCAGTATTAGAAAACTGCATAGAGTGTATTTTAATTTCACATAAAAAGGGAAAATCCGAAGGTTTTCTGCATGCCATAGACAAAGGAGACATACCACTATCTACTTACCATATTGACCATTTGGGACCGTTGACATCAACAAATAAGAATTACAAGTATATACTCACAGTTGTAGATGGGTTCACAAAATTTACATGGATTTACCCAACAAAGACTTTGTCCACTGATGAAGTTATTGACAAACTGAAGATTCAACAACAGACTTTTGGTTCACCACAGAGGATTATTAGTGACAGAAGTACCTCCTTTACATCCAACACTTTTAAAGAATTTTGTGAAACTGAAGGAATCTTACATCACATTATTACTACTGGCCAACCTAGAGGTAATGGTCAGGTTGAGAGAGTCCATCAGATAATAATTGATGCTCTAAGTAAATTATCAGCAGATGATCCCACCAAGTGGTACAAACACATCAGTAATATCCAGAGATGCTTAAATGGTTCATTTCAAAGGAGCATTAAGATGTCACCCTTTGAATTACTGACAGGAGTCAAAATTAATAATAAAAATGAAGCTATCTACAATTTAATTAAGGAAGAGAATCTTAAATTTTTCTGTGATGAAAGAGAAGACTTGAGGAAGAAAGCAAGGGAGAACATACAAAAAATTCAAGATGAGAATAGAAGAAATTTTAACCGAAGACGAAGGAAACCCAGAGAATATGAAGTAGGAAATCTTGTTGCTATCAAGAGGACACAATTTGTGCAAGGCTACAAACTGCATCCAAGATACTTAGGACCTTATGAAGTCGTGAAAAAGAAGAGGAACGACCGTTATGATCTCCAGAGGATTGGTCAAGGTGAAGGACCCCATCACACCAGTAGCTCCGCGGATATGATGAAACCTTGGGTCGCTGATGTTGTCGAGTATGAGTCATCTGGGGCAGACGACTGA
Protein
MPRKGAKEDEECFAEPAPQISFCELEKSMTAFSGDDAYGVDTFIKDFEDIANLMQWTGIEKLIYAKRLLKGTAKLFLRSLTGTTTWELLKTGLKEEFGLHLNSAAIHKTISNRKMKPGETYRQYFLQLKELAVLGNIEDDALMEYIIDGIPDNEMNKTILYGASNIKEFRKKLDLYAEIKKKCRTSNKAYNQSTTSKPTTSGWKKPLPKKRCFNCGDLDHESSGCSKGIKCFRCNDFGHKSTDCPKNIKKTLEIKCNKENDSQAPYKEVLINNVMVKSLIDTGSDVNLMNESTFTQIQGDTCNYHPDLVQSLTGIGDCEVHTRGSCTPRIEIDGCQCEATFYIIEDDKIPVDVIIGNPILQDIELSFKSGVISAKRILQLTMLEDQAEEPMIIGNFKYKDQIEKILTEYDPGKCSKESKVELKLLLTDETPVYQNPRRLSPLELEIVDKQIKEWLKDGIIKPSNSDFASPIVLAKKKNKGYRLCVDYRKLNKKIIKERFPLPLIEDQIDRLKDATMFTTLDLKNGFFHVNVCKESQKYTSFVTPRAQFEFQKMPFGLSVGPSVFQRFVNDVFQDLILDGVVLTYLDDLILPFKLPKEGIEKLQKVLYRAEEYGLTFNWSKCQFMQKKINYLGYIIEDGKISPSKEKVTAVARFPTPHNIKTLQSFLGLTGYFRKFIKNYSLIARPLTNLLKNGVIFNYDEECEKAVETLRTILCQSPVLQIYNQDLETELHTDASADGYGAVLLQRNLKDNKMHPVYYMSRKTSPAEKKYHSYYLEVLAVVEAIKKFRVYLLGIHFKVITDCSALTTTLKKKDLPPRVARWALLLEEYNYTIEHRPGIRMKHADALSRQPVENIFILTDTTARLRRAQDDDLKIKLIKKVLEKEHYDDFMIEAGILWKIKDGKKLMVVPKKIQNEIIRKNHDKGHFGLIKTEELISRNYYFENMKDKIKSVLENCIECILISHKKGKSEGFLHAIDKGDIPLSTYHIDHLGPLTSTNKNYKYILTVVDGFTKFTWIYPTKTLSTDEVIDKLKIQQQTFGSPQRIISDRSTSFTSNTFKEFCETEGILHHIITTGQPRGNGQVERVHQIIIDALSKLSADDPTKWYKHISNIQRCLNGSFQRSIKMSPFELLTGVKINNKNEAIYNLIKEENLKFFCDEREDLRKKARENIQKIQDENRRNFNRRRRKPREYEVGNLVAIKRTQFVQGYKLHPRYLGPYEVVKKKRNDRYDLQRIGQGEGPHHTSSSADMMKPWVADVVEYESSGADD

Summary

EMBL
LBMM01010976    KMQ87102.1    ABLF02014660    ABLF02042774    GBBI01004549    JAC14163.1    + More
GBBI01004550    JAC14162.1    GBBI01004551    JAC14161.1    GBXI01005773    JAD08519.1    GBBI01004477    JAC14235.1    GBBI01004613    JAC14099.1    ABLF02005846    GEHC01000930    JAV46715.1    GAMC01007326    JAB99229.1    GBXI01004632    JAD09660.1    GAMC01015907    JAB90648.1    GAMC01020207    JAB86348.1    LBMM01011782    KMQ86633.1    LBMM01005919    KMQ91096.1    KMQ91095.1    ABLF02005127    ABLF02005129    ABLF02007401    GGFK01005990    MBW39311.1    GAKP01019383    JAC39569.1    GAKP01016237    JAC42715.1    Z27119    CAA81643.1    GAKP01016235    JAC42717.1    AY050234    AAK84933.1    GGFL01001689    MBW65867.1    GFTR01008753    JAW07673.1    GGMR01015682    MBY28301.1    ABLF02041876    GGMR01005091    MBY17710.1    ABLF02017401    ABLF02033943    ABLF02042737    GEZM01033083    JAV84424.1    ABLF02004401    ABLF02013544    ABLF02013550    GEHC01000876    JAV46769.1    ABLF02008401    ABLF02008404    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GGMR01016004    MBY28623.1    GEHC01000888    JAV46757.1    ABLF02022032    LBMM01008871    KMQ88569.1    GEHC01000891    JAV46754.1    KA649989    AFP64618.1    GGMS01012726    MBY81929.1    LBMM01004291    KMQ92598.1    EF710649    ACE75273.1    LBMM01006880    KMQ90234.1    GGMS01015422    MBY84625.1    GAKP01001563    JAC57389.1    GBHO01030786    JAG12818.1    GDHC01004980    JAQ13649.1   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF00098   zf-CCHC
PF02037   SAP
PF17917   RT_RNaseH
PF09668   Asp_protease
PF03732   Retrotrans_gag
PF00077   RVP
PF12384   Peptidase_A2B
PF13873   Myb_DNA-bind_5
PF16064   DUF4806
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR036361   SAP_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR003034   SAP_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR005162   Retrotrans_gag_dom       
IPR018061   Retropepsins       
IPR024650   Peptidase_A2B       
IPR034145   RP_RTVL-H-like       
IPR028002   Myb_DNA-bind_5       
IPR032071   DUF4806       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF68906   SSF68906       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=1.25048e-72,     Score=699

Ontologies

Topology

Length:
1267
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00303
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00018
outside
1  -  1267
 
 

Population Genetic Test Statistics

Pi
54.590231
Theta
58.140811
Tajima's D
-1.053296
CLR
144.121621
CSRT
0.132143392830358
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号