SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04863
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Nuclear   Reliability : 1.89
 

Sequence

CDS
ATGGCACCTGTGAAGAACTTATTACCCCAGGAGGGTACCTCCCGCTCCGCGGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGCACACACTGCCACGAGGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCAACCGTGCTACTCGAGCGCTGCGAGAGTTTGATCTCGTTGCACTCGGCGCGGAGCTCCGCGAGGGGCGACGCGTCTAGTGGGCGGGAGACGCCAGCGCTGTTCGTAGACAGCACTCGACAGCGAACGCGGCGGAAGCGGAAGTCGGCTCGACGGCCGGCGTCCTCCGCTCCGTCAGATTCGTCAGACGGTGAGCCCGCTAGCGCCAAATATATGGCGTTGGCGGAGGGGCCGGCGACTGCTGCAGCGTCGCCCGCCACCGATTGTAACATGATATCTTCCGGCGGACTGGCTGCTGCCCCCTCGGTGCAGACCAGGGCCGCCCGCCGTGAGGCCCAGGAAAAATCAATTGGAGAGGTTGAGCGCCTAGAGCGCTCCCTACTAGAGGTAGGTCCCTCTGACCACCTCAGAGCCTTTGAGGTGGTCGGAAAGCTTATGACGGCGATCGCCACAAAATCCAGCGCTGGTCTGAAGGGCGACTATTTGCGGGCCCTTAAATCTGCATCTGCCACCCTAGAGGAGCGACGAAGAGAGGTGGTGAACCGCACTACGACGACGGAGACGGCGGCCGTGCGACAGGAGTTGGACCTGATGCACGCCCGCTTCGACCAGGTATCGAACGAAAATGACAAACTTCGAACGGAGAATGGGCAGCTGCGCGTGGACATGGCCGAGTTGAGGACCATGGTTGCCGACCTCATCGAGCGGCAACGCAGCTCTGCCCTTGTCCCTCCTCCGCTAGAAGCGGAAGGCCTCAGTGAGGTCGAGCAGTTGAGGCGGCAGCTCCTCATACAGGAGGCGCGCAGCTCCAAGGTGGAGCGCGCGAGACCGCCCCTCGCTCACGAGGCTAAGGGAAGCGCACCTGTGCCGGCACCCCGCAGGAGTGTGCAGCCCGCTGCAAAAACATACAGCGGGAAGAAGATTACACCCGCGCGAGCTCCCGCTGCGGCTGCACCTAAACCCACGGCCCCCGCATCTAAACCGGTGTCCGCTCCTGCCCCGTCCCAGCCTGCGAAGGCGGGGCCCGGCAGGAGCCGGACCAAGAAGAAGGGGGGCGTCAACGCCGCCAAACCGGCACCGACCCCCCAGCCCCGCCCACTGCCCCCGGCCCCGGTAAACATGAACGAGGCCTGGACGACGGTGGTGCGGCGCGGGCCCAAAAAGGTGGCGGCGCCTCCTGCGCCGCGCCCCAAGCCCGCCCCTGCGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAACTGGAAGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGCGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCCTGAGGGTCCGGCAGACGGCCAACGTGCAAATCCGCCCCCTCCTCAACCAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAACAAGGGCAGCCGGGCACAGGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATAGGGGACGTCGTCGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTGCACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGAGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCGCCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACTGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGTACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATAGTTTCTGCGCTTTTCCCGCCGGCAGCGGGGGGGGATTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAGGCGGGCAAGATGCTCGAGAGGATCGTCGCCGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTAGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCTCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTTTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGTGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGGCCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGATCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTACCCCAGGGGACCGACCCCTGGTTAAACAAAAAGGAAACAAAACATGAAATGGCATCTGTTCCAAAACTACTACCCCAGGAGGGTACCTCCCGCTCCGCGGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGCAAACACTGCCACGACGAAGGGGGCGACAACACGGGTCGCGTAAGGGACAAAGTCCCCACCGTGCTGCTGGAGAGGTGCGACAGCCTCATCTCGCTGCACTCGGCGCGAAGCTCCGCGAGGGGCGACGCGTCCAGTGGGAGGGAGACACCGGCGCTGTTTGCCGATTGTGATCGGCAGCGGACTCGGCGGAAGCGGAAGTCGGCTCGTCGGCCGGCGTCCTCCGCTCCGTCCGATTCATCGGAAGGAGAGCCTGCCAGCGCCAAGTATATGGCGTTGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCCGCCACTGATTTGGACAAGCCGTCGACTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCCGTGAGGCGATAAAAAAGAATAGGAAGCTGGAGGAAATCGAGCGCCTACAGCGATCCCTGACGGAGGTGGGACCATCTGACCCCCTCCGAGCTTGTGGAATAGTCGGGAGAATAGTCGCGACCATTGCGGCTAAATCCACTGCAGGCCTCAAGGGCTCGGAATTGTCGGCCATGAAATCGGCGGCCGCCACGCTCGAAGAAAGGCTGCAGGACGTTGTGGACCGCACCACAACCGTGGAGACGGCGGGATTGCGACAAGAAGTGGCCCTGCAGCACGCCCGCCTCGAACAACTGGCGGATGAGAATGGCCAACTTCGGGCGGAGAACGGACAGCTCCGCGTCGACATGGCCGAGCTGCGAACAATGGTTGCCGATCTCATCGAGCGGCAACGCAGCTCGGCCCCTGTCCCTCCTCCGCCCGAAGCAGAAGGCCTCACTGAGGTCGAGGAGCTGAGGCGGCAGCTCCTTATACAGGAGGCAAGGAGTTCGAACGTTGAGCGCGCAAGACCGCCCCTCGCTCATGAGGTGAAAAACGGAGCTCCTACACCGGCACCCCGCAGGACTGTGGCCGCTAAAATGTATAGCGGCCCTAAAAAGGGCGCGACACCCGCGGCACGTCCGGCTGCTTCGGCTTCTGTTCCGGCCAAACCAGGACCATCGGGGACCCAAAAAGATACGGGGGCACCAAAACCCGCTCCCTCAGGAGCAAAAAGCACCGGCCAGCGTATGACGCAGAAGACTGCTCCTGCCCCGTCCCAGCCTGCGAAGGCGGGGCCCGGCAGGAGCCGGACCAAGAAGAAGGGGGTCGTCAACGCCGCCAAACCGGCACCGACCCCCCAGCCCCGCCCACTGCCCCCGGCCCCGGTAAACATGAACGAGGCCTGGACGACGGTGGTGCGGCGCGGGCCCAAAAAGGTGGCGGCGCCTCCTGCGCCGCGCCCCAAGCCCGTCCCTGCGGCTGCCGCTCCCCGCCAAGGGGGTCGAGCGGAGCCGAGGGGCCGAACTGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTTGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGTGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCCTGAGGGTCCGGCAGACGGCCAACGGGGCCCGCCTGGTAGAATGCCCCGGCGCGAATTCCAGCGCCGCGGCAGAAAAACTGGCGGTCCGTCTGCGGGAAATCTTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTCAAAATGGCGGAAGTAAAAATTACGGGCCTCGACGAATGCGCCACCAAAGAGGAAGTCGCCGCGGCCATTGCGTCGCAGGGCAACTGTGCCCTCGCCGACGTAAAAGTTGGGGAGCTTCGGCCTACATATATCGGAACCCGGACGGCGTGGGCGCGTTGCCCGGTAGCAACGGCGACAGTCCTGGCTACCCCTCCACAGGGTCGGCCTTCGGACAGCCCGGGACAACTGCGCGTGGGCTGGGTGGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGCTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACAGTGGACCGCAGCAACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCATCCTGCACCGCAGCCGCGCCGCACTGTGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAATCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGTGAGTCAGCTCCCGCCGCGGCACGAGAAGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATTGATGTTGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATCGTACTAAGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAATTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACCTCAACGCCAAGTGTACGGCTTGGGGTTCCCCCCGCACGGATTCGCGAGGCGGGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGTGGGCGCCCGCGGCGAAGAGGAGCTCCCGCAAGGTGCGCCTCGTTCGTTCCCCAGGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTGCGTTCGCGGAGACGGCGGCCCAGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAGATAGTTTCCGCGCTTTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACACCTCCACGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAAAATGAGAGCGAAGGACACGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGACGAAGCTGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTTCCGGTCGAGCGCGGTGTTCCGCAGGGGCGTGGCACACGTCGTCACAAGGATCCGACGGCTGGGACTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTGTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCAACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGGTGCCACGCCCTGACCCGCAAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGAAGCGACCTTCGTTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAAATGTTGACCGGCCATGGTTGTTTTGGCCGGTACCTTTTCAAAATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCTGACCGCGACGAGGAAGACACAGCGGAACACGCATTGGCGCGTTGCTCTGGATTTGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGAGGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MAPVKNLLPQEGTSRSAGGESLRAVERSAARCPTVSGGGTHCHEEGGDSTGRVRDRVPTVLLERCESLISLHSARSSARGDASSGRETPALFVDSTRQRTRRKRKSARRPASSAPSDSSDGEPASAKYMALAEGPATAAASPATDCNMISSGGLAAAPSVQTRAARREAQEKSIGEVERLERSLLEVGPSDHLRAFEVVGKLMTAIATKSSAGLKGDYLRALKSASATLEERRREVVNRTTTTETAAVRQELDLMHARFDQVSNENDKLRTENGQLRVDMAELRTMVADLIERQRSSALVPPPLEAEGLSEVEQLRRQLLIQEARSSKVERARPPLAHEAKGSAPVPAPRRSVQPAAKTYSGKKITPARAPAAAAPKPTAPASKPVSAPAPSQPAKAGPGRSRTKKKGGVNAAKPAPTPQPRPLPPAPVNMNEAWTTVVRRGPKKVAAPPAPRPKPAPAAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGLRVRQTANVQIRPLLNQNEEGRKEKEAGCNKGSRAQDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWIGDVVGSVAIVLRQSAALPPLDMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRARGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHCRRRRRDATFAETAARLYADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLGQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPLPQGTDPWLNKKETKHEMASVPKLLPQEGTSRSAGGESLRAVERSAARCPTVSGGGKHCHDEGGDNTGRVRDKVPTVLLERCDSLISLHSARSSARGDASSGRETPALFADCDRQRTRRKRKSARRPASSAPSDSSEGEPASAKYMALAEGPAAAAAPPATDLDKPSTCGLDAASSAQSRAACREAIKKNRKLEEIERLQRSLTEVGPSDPLRACGIVGRIVATIAAKSTAGLKGSELSAMKSAAATLEERLQDVVDRTTTVETAGLRQEVALQHARLEQLADENGQLRAENGQLRVDMAELRTMVADLIERQRSSAPVPPPPEAEGLTEVEELRRQLLIQEARSSNVERARPPLAHEVKNGAPTPAPRRTVAAKMYSGPKKGATPAARPAASASVPAKPGPSGTQKDTGAPKPAPSGAKSTGQRMTQKTAPAPSQPAKAGPGRSRTKKKGVVNAAKPAPTPQPRPLPPAPVNMNEAWTTVVRRGPKKVAAPPAPRPKPVPAAAAPRQGGRAEPRGRTGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGLRVRQTANGARLVECPGANSSAAAEKLAVRLREILPDPEVVRIARPVKMAEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRPTYIGTRTAWARCPVATATVLATPPQGRPSDSPGQLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSNLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESAPAAAREEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLDMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDLNAKCTAWGSPRTDSRGGALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAVGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDAAFAETAAQLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSKMRAKDTAPGPDGVHGRVWSLAFEALGDRLGGFSKRASSRDAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGRGTRRHKDPTAGTRGGARQNPGPVVSRAGTSAASGCPPRDRRRPRRGRGDRSSVPRPRTGWSVELPRSLCEVGPSTDGNGRLFEPAASKRRGPDQVARRLYMGVVRSMALYGAPVWCHALTRKNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHALARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSEASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.63872e-09,     Score=159

Ontologies

Topology

Length:
3376
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.736670000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  3376
 
 

Population Genetic Test Statistics

Pi
125.015131
Theta
19.038905
Tajima's D
0
CLR
14.244211
CSRT
0.373381330933453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号