SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04846
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.47
 

Sequence

CDS
ATGACAAAGCCTCGCACACGTCGTCAGTCTCGTCGACAATCCGAGTATTTTGAACCGACAGAGGACGATTCTTCCCCGCCGCCGACTGCATCGGGAAACATTTCCGTCAACGACATGGTCGCCATGATGTCTACGTGGCAACGCAACCAAGAGGAAACGTTTGAGAAACTTCTACATACAGTTCTCAACCAATCGCACCGGTCATCGCCGCCGCCCGCTCAACCTGCACTTGGAAACTTCGCCTCGTGCAAGGCTCGCTACAGCGGAGCGCCAGACGAATCACTTGACGGATTTATAGACGCCGTAGAGGCCTACAAGGAATGTGCAAACGTAAGCGAAACTAATGCACTACGTGGGTTGTCAATGTTGTTAACTCATGAAGCCGCGACATGGTGGCAAGGAGTTAAGACCACCATGAACAAGTGGGACCACGCCCTCACATCCCTAAGAGGTGCGTTTGGTGATAGCCGACCTCCACATCGTATATACAAGGAGCTGTTCGCCAACCCACAAAAAGCAAGTGAGAAAACAGAACTCTTCATCTCTAAAACTCGAGCGCTACTATCACGTCTGCCAAAGGACGATCTGACAACCAAAGTACAGATGGACATGGTGTATGGACTACTACATAGTAAAATACGCGAGCGTTTGAGAAGAGAGGAGATTGACACATTTGACACGCTACTCAGAAAGTCTAGAGAGATAGAAGAATCTTGTGACGAGAGTCTATCAACTAGTGGCCTTCAGAGCAAACTGCGCCAACGACAGTTTCCACCGCCTCGTCATGCCGCAAGCATCGCCGCTGTCCAGGGGTCAACGACCGCGCCACCACTACCACCGCAGAGCGCGCCTAAGCCGCCTGCGCCCGCCGTTGAGTCCAGCGCCCACGGCACCTATCGCCGTTCTCTTCGCTGCTCCGTGGTGCCGCCCCCACCGTCGTCTCCACAACCCCACGGCTCTTCTACTCAGTTCGTGAACGCCAGACGTCGATATTGTTTCTATTGCAAGAACTATGGACATACACGTGAAGAGTGTCGTAGGTTAGCAGCTAAAGGCAAACAGGACATCGATAACGCCGCCGACCCCGTCCCGTCGTGTTACGGATGCAACGAGAAAGGTGTCACTCGATCACAGTGTGCTAAATGCAATTCGGACTTCTCTGCGTGTGAATACGACGGTCCGAAAGGCGCGCTGATGGGAATTTACGGTACAAGGTACTCCACCACTGTTATCAAATCATCTTGTAATAAGGATGAGACCCAGGTTGACCATGCAGGACGATTGTAA
Protein
MTKPRTRRQSRRQSEYFEPTEDDSSPPPTASGNISVNDMVAMMSTWQRNQEETFEKLLHTVLNQSHRSSPPPAQPALGNFASCKARYSGAPDESLDGFIDAVEAYKECANVSETNALRGLSMLLTHEAATWWQGVKTTMNKWDHALTSLRGAFGDSRPPHRIYKELFANPQKASEKTELFISKTRALLSRLPKDDLTTKVQMDMVYGLLHSKIRERLRREEIDTFDTLLRKSREIEESCDESLSTSGLQSKLRQRQFPPPRHAASIAAVQGSTTAPPLPPQSAPKPPAPAVESSAHGTYRRSLRCSVVPPPPSSPQPHGSSTQFVNARRRYCFYCKNYGHTREECRRLAAKGKQDIDNAADPVPSCYGCNEKGVTRSQCAKCNSDFSACEYDGPKGALMGIYGTRYSTTVIKSSCNKDETQVDHAGRL

Summary

Pfam
PF00077   RVP
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
428
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00812999999999999
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.06123
outside
1  -  428
 
 

Population Genetic Test Statistics

Pi
222.295068
Theta
161.056708
Tajima's D
1.129358
CLR
0
CSRT
0.693015349232538
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号