SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04843
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.415
 

Sequence

CDS
ATGTTTGTTTGCAATAGGGTTAATGAAATCAACGAGTTAACAAGTACTTTTGAACACAGACATGTACCTACGAATATGAACCCAGCTGACTTGGCCTCAAGGGGGGTCGAACCCCATGACCTTTTGTCTTCCTCTTTGTGGTGGGAAGGTCCTTCTTTCCTGAAGAAGGAACGTTTAGAATGGCCACAGAATTCTTTCGTAGTTCAAAACTTACCTGAGTTAAAGATATCTGCTCCGGATGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGCGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCCGTAGCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAACATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGCCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTTCCACTCTCTCGTCCTGATCGTCGAACGACGACCGGGTATCGAAGAGTTTGGCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCAGGACCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAAGGCGAAGTCGGAGCACGTTGCTAGAATTGGCGAGCGACTGAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTTTGCAGGTGGGCTGAAGCCTTGGAAAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCTACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTACTGCTCCCATCTCTGGGCTGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCAGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTCGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MFVCNRVNEINELTSTFEHRHVPTNMNPADLASRGVEPHDLLSSSLWWEGPSFLKKERLEWPQNSFVVQNLPELKISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGRSRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPDRRTTTGYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRQDPNISEERRKYNAASRSYKKVIAKAKSEHVARIGERLKSYPSGSRAFWSLAKAAEGNFCRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRMEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFSSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
822
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00389
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00014
outside
1  -  822
 
 

Population Genetic Test Statistics

Pi
221.9783
Theta
154.07311
Tajima's D
1.931709
CLR
252.981909
CSRT
0.871206439678016
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号