SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04832
Pre Gene Modal
BGIBMGA009925
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]-like_isoform_X1_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.037 Extracellular   Reliability : 1.346
 

Sequence

CDS
ATGAGGTGCCTGGTCGCCTGCTCCCCCATGGCCGATGGAGCCGCGTATGATTACGTGGTGGTAGGAGCTGGGGCTGCGGGCGCCGCGGCCGCCTCTAGGTTAGCATTGAAAGGTTTCGATGTTATGCTTATAGAAGCCGGAGGCGATCCAAGCTTCCTATCTACGATACCGATGGCGTCGTTGGGTCTCCTTGGCTCCTCACTGGATTGGCAGTACAAGACTATTCCAAACAACATATCCTGTCTCTCTTCAATTGGTGAACAGTGTAGATTCAGTCGTGGAAAGAGCTTAGGAGGAACCACCGCTATCAATCACATGCTGTACATAAGAGGAAATAGATATGATTACGACAGAATGAACATCTCAGGGTGGACATGGAAGGACTTAGAGCCGTATTTCCTTCGATACGAAGGTCTTCAAATTTTAGACCAGTATCCAGCCAGTTCAAGGAAATATCATAATAGTAATGGTACTATGAAATTGGAGTATTTTGATGATCCGCGTAACCCATGGCACATGAGAACTGTTGAGGGGTTAAAGCAGCTAAATATACCTTATAATAAGGATTTGAACGGAGAGTATCAAATAGGAGTTACAAAAGTAGCTGGTTATGTATATAAAGGAGAGAGGATGAGTACCGCGCGGGGCTACCTAGCAAGGAATGATGTTAAGAAAAATCTTAAAGTTGCAAAGAATGCTTTTTGTACTGAAGTAGTTATTGATGACGACAATATTGCTCGAGGAGTGACAGTTGTCCAAAATCTACAAAAAGTTACAATATATGCAAGAATCGAAATTATACTTAGTGCTGGAGCGATTGGAACCCCTCAGATATTGATGCAGTCAGGTGTCGGTCCAGCTGACCACTTACAAGAAATGGGCATATCAGTACGATCAAACCTTCCCGTCGGTAATGATATGAGTGACCATCAGCTACCAGTAGTCATCGTCAAAGTAGACCACGGAGGAATAGTAGACAGCCTCGTTGGACTGACTTCTAAAGCACCCCAAGTATTACAGTACTTGGCCTCCAGGAGCGGACCACTAGCATCTAATAGCCTACAAGATATAGTGACATTGATAAACACTAACTGTTACGATTTTGATCTTCGTCAGTATTCAGGTAATAGTAGTCGGTGCGAGCTCGCTGATATGCAGATTATTCAGTCGTACATAGACAAAGGATTGGTGGCTTTAGCAAAGCCTTTGGTTAAGCAGGCTATTGGTTTCAATGACCAAGTCTTAGACCAAATTGAGAAGGCGAACGAGAACCATGGCTTGATTGTTTTCTCGCCTATGGTTCTGCAGCCATATTCTCGTGGCACCGTCCGCCTCGCCAGTATTGATCCACTGCAACCACCAGCAATCTTCGCTAATTATCTTGGAGATGAACGAGACGTCGAACAAATGGTAAAATCTATCACTTTCTTGGAGCACCTGATGAAAACTCAGATCTTCAAAAAACACAAAGCCTCAATCTTACATTTGAATCTACCTGGATGTCCAGCCTATAAATGTGGAAGGGTAGAGTATTGGAGATGCTACGCCAGACATATGACTTATTCTGGATACCATGCTGTAGGGACCTGTGCGCTGACCAGGGTGGTAGATGAACAACTCCGTGTGTATGGTGTAAAGAACTTAAGAGTGGCCGATTTGAGTGTACTGAAAAATATTATAAGAGGAAACACAGCATCTGTTTCTATAGCTATTGGAGAGAGAATTGTGGATTTTTTAACTGAGGAAGATAATCCATAG
Protein
MRCLVACSPMADGAAYDYVVVGAGAAGAAAASRLALKGFDVMLIEAGGDPSFLSTIPMASLGLLGSSLDWQYKTIPNNISCLSSIGEQCRFSRGKSLGGTTAINHMLYIRGNRYDYDRMNISGWTWKDLEPYFLRYEGLQILDQYPASSRKYHNSNGTMKLEYFDDPRNPWHMRTVEGLKQLNIPYNKDLNGEYQIGVTKVAGYVYKGERMSTARGYLARNDVKKNLKVAKNAFCTEVVIDDDNIARGVTVVQNLQKVTIYARIEIILSAGAIGTPQILMQSGVGPADHLQEMGISVRSNLPVGNDMSDHQLPVVIVKVDHGGIVDSLVGLTSKAPQVLQYLASRSGPLASNSLQDIVTLINTNCYDFDLRQYSGNSSRCELADMQIIQSYIDKGLVALAKPLVKQAIGFNDQVLDQIEKANENHGLIVFSPMVLQPYSRGTVRLASIDPLQPPAIFANYLGDERDVEQMVKSITFLEHLMKTQIFKKHKASILHLNLPGCPAYKCGRVEYWRCYARHMTYSGYHAVGTCALTRVVDEQLRVYGVKNLRVADLSVLKNIIRGNTASVSIAIGERIVDFLTEEDNP

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01026760    BABH01026761    JTDY01001166    KOB74675.1    KZ150126    PZC73113.1    + More
AGBW02008930    OWR52172.1    AGBW02010600    OWR48201.1    NWSH01004950    PCG64563.1    JTDY01000443    KOB77147.1    RSAL01000892    RSAL01000018    RVE41068.1    RVE52863.1    JTDY01004610    KOB67954.1    RSAL01000051    RVE50264.1    KY618825    AQW43011.1    GEBQ01016745    JAT23232.1    KU764422    AQS60669.1    GL732535    EFX84138.1    KK107261    EZA53937.1    GDIP01146283    JAJ77119.1    QOIP01000012    RLU16172.1    GL442298    EFN63615.1    GFDF01001806    JAV12278.1    GBYB01002620    JAG72387.1    AAZX01008029    GFDF01001756    JAV12328.1    LJIG01001624    KRT85316.1    GGMS01010167    MBY79370.1    PYGN01000411    PSN46845.1    GDIP01219778    JAJ03624.1    GFXV01007441    MBW19246.1    JH431861    KQ971348    EFA05531.1    GGMR01012313    MBY24932.1    NEVH01005904    PNF38181.1    KQ981296    KYN43080.1    LRGB01001036    KZS13782.1    KQ434869    KZC09326.1    GDIP01121629    JAL82085.1    KQ435704    KOX80305.1    GL763984    EFZ18935.1    NEDP02005158    OWF43153.1    LBMM01005695    KMQ91287.1    EFX84139.1    PYGN01000027    PSN57097.1    GL888284    EGI63349.1    GDIP01187565    JAJ35837.1    KQ414579    KOC71128.1    ABLF02037928    RLU16179.1    KQ980314    KYN16692.1    GBYB01011122    JAG80889.1    JH430884    GECU01004364    JAT03343.1    GECU01001143    JAT06564.1    LBMM01015561    KMQ84762.1    NEVH01020853    PNF21087.1    NEDP02004628    OWF45028.1    GDIP01177544    JAJ45858.1    ATLV01017501    KE525172    KFB42226.1    ADTU01026685    AAZX01001588    KQ982905    KYQ49514.1    LNIX01000033    OXA40505.1    KY618826    AQW43012.1    GDIP01177545    JAJ45857.1    DS235784    EEB16963.1    GDIP01177546    JAJ45856.1    CH954180    EDV47071.1    GBXI01017045    GBXI01016813    GBXI01008932    JAC97246.1    JAC97478.1    JAD05360.1    ODYU01012241    SOQ58442.1    GFDF01002042    JAV12042.1    GAKP01015844    JAC43108.1    NWSH01004668    PCG64789.1    GL448571    EFN84147.1    KZC09325.1    PSN57098.1    GDIQ01207189    JAK44536.1    GDIQ01162162    GDIQ01145021    GDIQ01143630    JAL06705.1    GFDF01002041    JAV12043.1    GEBQ01006583    JAT33394.1    GDIQ01200150    GDIQ01198855    JAK52870.1    GDIP01167184    JAJ56218.1    GBXI01010590    GBXI01000279    JAD03702.1    JAD14013.1    GDIQ01051491    JAN43246.1    GDIP01228120    JAI95281.1    GDIQ01051490    JAN43247.1    GECZ01026787    JAS42982.1    GDIQ01101823    JAL49903.1    NNAY01002979    OXU20190.1    GDIQ01101824    JAL49902.1    KYN43077.1    KQ759784    OAD62856.1    GDIQ01201409    JAK50316.1    GDIQ01198854    JAK52871.1    LJIJ01001277    ODM92293.1    GDIQ01051489    JAN43248.1    GDIP01238481    GDIQ01236187    GDIQ01234983    JAI84920.1    JAK15538.1    KQ980881    KYN11981.1    OAD62857.1   
Pfam
PF00732   GMC_oxred_N        + More
PF05199   GMC_oxred_C
Interpro
IPR000172   GMC_OxRdtase_N        + More
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
IPR036188   FAD/NAD-bd_sf       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
4YNU     E-value=1.11236e-35,     Score=377

Ontologies

Topology

Length:
585
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.25918999999998
Exp number, first 60 AAs:
7.16612
Total prob of N-in:
0.32831
outside
1  -  585
 
 

Population Genetic Test Statistics

Pi
5.171972
Theta
7.508879
Tajima's D
-0.866909
CLR
1.016104
CSRT
0.16369181540923
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号