SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04797
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.195 Nuclear   Reliability : 1.238
 

Sequence

CDS
ATGGATTGCGTGAATTTTACGCATCCTACCCATGGGCGGTTCTGCTCTGCTGATCCTGACATCTATGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTCGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTCTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACAATCTGGCCCACAGCGTGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCCCCGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTATAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATTATAAATATACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTTGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGATAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAACAGAGGAAGAGAAAGCGACTCAGTAGAGATTTCTTCAATAGGCAATGCATGGAAATGCATGGACGCCCAGTTTTCTATTGAAGCAACTAAAATCTTTAAAAAAGCAAAAGAATCACCTAAACGTAAACCTCTGAAACAGGCATGA
Protein
MDCVNFTHPTHGRFCSADPDIYADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDNLAHSVKEKADLLVKLFASNSTVDDGGATPPNIPRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRANRGRESDSVEISSIGNAWKCMDAQFSIEATKIFKKAKESPKRKPLKQA

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00002   7tm_2
PF00078   RVT_1
PF01585   G-patch
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000832   GPCR_2_secretin-like       
IPR005135   Endo/exonuclease/phosphatase       
IPR017981   GPCR_2-like       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF54928   SSF54928       
Gene 3D
PDB
6AR3     E-value=7.16716e-06,     Score=120

Ontologies

Topology

Length:
530
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01994
Exp number, first 60 AAs:
0.00014
Total prob of N-in:
0.00265
outside
1  -  530
 
 

Population Genetic Test Statistics

Pi
18.011523
Theta
22.449632
Tajima's D
-0.770778
CLR
37.504415
CSRT
0.184290785460727
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号