SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04780
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.387 Nuclear   Reliability : 1.409
 

Sequence

CDS
ATGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATCCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGCGGAAGTTCGAGCGCGAAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGGGTGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCTCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTTGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGTGGCGGAACGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MSAARDCGQGGSWIRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRVTQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEVAERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF00732   GMC_oxred_N
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF51905   SSF51905       
Gene 3D

Ontologies

Topology

Length:
237
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06642
Exp number, first 60 AAs:
0.03458
Total prob of N-in:
0.09468
outside
1  -  237
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
-2.086346
CLR
31.296559
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号