SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04773
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.472 Nuclear   Reliability : 1.374
 

Sequence

CDS
ATGATGACTCGCAGCATCAAATCTCGTCAGGTTGATGAACAGCTTCGTATTGCTTTAGAACAATTAAAAAATACTCGCGAAAAATATGATATACTTTTACAAGAAAGTGAACAAAATGAAGAGGAGATGCTGTCAGTCATCTCTAAGAATACTGACCTTAAAAAACAATTGTCTCACCTCTTCATTGAACACAGTGAAGCTCTTGAGACCAACCAGAAGTTGCAGGATACGATTAACACCTTTTCTCAATGCAGTGATGAATTTTGTGATTCATTGAAAATCACCGCTGAGTTGAGACATAAATTGGCTGAGGCTGATGATTGTATTTCTGACTTGCGATACTGCCTTTGGGCACTGAAGCGCCTGAATAAGGTGCTCGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTCGGAGGCCGATTGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGCCGCGCTCCACGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCACTCCTCAGAGAGGAGTGCGTGCGGGCACGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGTCTTCGCGGTATGGATTTCGCGGAGGTGGCGGCCCGCTTACATGCCGACTGCCGTGAAAAGCAGGAGGTTCTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTCGATCAGGATCCCTGGGGGCGCCCGTACCAGACGGTACGCAAGAAATTGCGACCGTGGGCGCTCCCGGTGACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGATATTGTCTCCGGGCTATTCCCGCGGATGGAGAGGGACTTTGAGCCCCCCTTCATGGGCGTGCCGCCACGCCTTGACGTGAGCGGTGATGCCCCTGCTGAGGTGGTTCCTCCGAGCATATCGGAGCAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAAGACGCGGCCCCCGGCCCTGACGGTGTTCACGGTCGGGTTTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCCTCGAGTCGGGGCGGTTTCCAAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCTGCGGACTCACCTGCGGGGTATCGTCCCATCGTGTTGCTGGATGAAGCGGGAAAACTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCACCTGACGGGAGTGGGTCCTGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCGGCCGGGGTGGGGTTGCACTGGCGGTGTCCCTGGACATCGCCAATGCGTTCAACACCCTGCCCTGGTCGGTAATCGCGGGGGCGCTGCAGTATCATGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGATAGGTCGGTCGTGTGCACCGGGCACGGTGGGACGGTGCTCCGCTTCCCCGTTGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCAGCTATGATTGGGTCCTGCGGAGCGCCCTTAGCGCTCCTCTCCCGGGTCTAAGCATAGTTTGCTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAAGGATTTGCGCGAGTCTGCTCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGACGGTTGGGTCTGGAGGTGGCGCTTGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTAGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGTGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTAGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAACTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACTGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MMTRSIKSRQVDEQLRIALEQLKNTREKYDILLQESEQNEEEMLSVISKNTDLKKQLSHLFIEHSEALETNQKLQDTINTFSQCSDEFCDSLKITAELRHKLAEADDCISDLRYCLWALKRLNKVLAVEAATVAAWAPMPARLVDVESEADWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRGMDFAEVAARLHADCREKQEVLRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLRDIVSGLFPRMERDFEPPFMGVPPRLDVSGDAPAEVVPPSISEQEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGRGGVALAVSLDIANAFNTLPWSVIAGALQYHGVPAYLRRLIGSYLEDRSVVCTGHGGTVLRFPVERGVPQGSVLGPLLWNISYDWVLRSALSAPLPGLSIVCYADDTLVVARGKDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078935    BAC06462.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    RSAL01003504    RVE40273.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01006657    KMQ90417.1    LBMM01002052    KMQ95336.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01015025    KMQ84953.1    LBMM01004505    KMQ92346.1    LBMM01005948    KMQ91066.1    LBMM01004634    KMQ92224.1    LBMM01003988    KMQ92922.1    LBMM01012412    KMQ86235.1    LBMM01005733    KMQ91252.1    LBMM01008278    KMQ89009.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01008422    KMQ88894.1    LBMM01014122    KMQ85315.1    GGMR01015159    MBY27778.1    ABLF02011238    LBMM01005474    KMQ91485.1    GGMR01014195    MBY26814.1    LBMM01004262    KMQ92649.1    LBMM01015285    KMQ84870.1    KU543683    AMS38371.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GGMR01011682    MBY24301.1    GFXV01002090    MBW13895.1    LBMM01004261    KMQ92650.1    LBMM01003245    KMQ93755.1    LBMM01005216    KMQ91703.1    ABLF02034925    ABLF02041886    GFXV01003903    MBW15708.1    GGMR01006838    MBY19457.1    GGMR01004600    MBY17219.1    GAKP01002292    JAC56660.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01005465    KMQ91492.1    LBMM01013668    KMQ85535.1    GALA01001777    JAA93075.1    AJ278684    CAB99192.1    GGFK01005660    MBW38981.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02059310    ABLF02041557    ABLF02021100    GEHC01000964    JAV46681.1    ABLF02023257    GGFJ01001369    MBW50510.1    AB090815    BAC57906.1    GGFJ01001370    MBW50511.1    GGFL01001583    MBW65761.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    GGFJ01001727    MBW50868.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    KQ971309    EEZ99146.1    LBMM01006977    KMQ90149.1    GGFJ01001439    MBW50580.1    AB593321    BAK38639.1    ABLF02007989   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=3.13621e-06,     Score=125

Ontologies

Topology

Length:
954
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.1083
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00498
outside
1  -  954
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
46.288938
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号