SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04765
Pre Gene Modal
BGIBMGA009225
Annotation
PREDICTED:_uncharacterized_protein_LOC105843021_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.663
 

Sequence

CDS
ATGAAGTGGAAAGAGTTAACGGGAATATTAAATAGCGATTCTTCAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGTGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAACAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTAACTGACCTTGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGAAGATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGAGGCCAAATACTGAAATTATTTTAAAGGAACCAGAAATAGATTGGAATACTCCGAGCACAAGCAGCCAACCAACAGTGGCTCCACCGCCACAAACTGAGGCTTCCCCTCCAGTCATTGACGAAGAGGAGTGGAACCCTCCGCCACAAAAAAAAAGAAAAAGCAATTTGACAAAAATGTTTTTAGATATAGACAGAAAGGCAACGGAGTATGCTTCAGAGCGTGATAGGGTATATGAGGAATTAGAGAGAGATCGGTTGAGAGTTAGAGAATTTGAGGTACGAGAAAGAGTAAGACAGCGAGATGAAGAGCTACGGATGCAGGGTCAATGGCTGGAATTTATGAAAGAGGCAATGGAAGCTTTTGTGAGGTTTATGGAGAGAAAGTCTTAA
Protein
MKWKELTGILNSDSSGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDLEQRVMQIIGVQAATGMKIKEAGFPQEEISTERPNTEIILKEPEIDWNTPSTSSQPTVAPPPQTEASPPVIDEEEWNPPPQKKRKSNLTKMFLDIDRKATEYASERDRVYEELERDRLRVREFEVRERVRQRDEELRMQGQWLEFMKEAMEAFVRFMERKS

Summary

Pfam
PF13873   Myb_DNA-bind_5
Interpro
IPR028002   Myb_DNA-bind_5        + More
IPR026753   NAIF1       

Ontologies

Topology

Length:
222
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04745
Exp number, first 60 AAs:
0.04648
Total prob of N-in:
0.07941
outside
1  -  222
 
 

Population Genetic Test Statistics

Pi
0.924631
Theta
4.202752
Tajima's D
-1.782229
CLR
8.250615
CSRT
0.023598820058997
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号