SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04735
Pre Gene Modal
BGIBMGA010465
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 3.435
 

Sequence

CDS
ATGGGAGAAGGCATAGAAGACCACGGAAAGTATATACTGCATTATAAAGGAGAAACACCAGGACAATACGGAGTTGGTTTTTTGATAAAAAGAAAATATATGGACCGAATCGAGGAATTGAAGGGCATATCCGAAAGAATAGCAATACTCAACATCAAATTTCCCGTACAAAATAGCAGAGACGAATTATGGTCAATTATTCAGGTTTACTCGCCAACTGAAGCAGATAAAAAACAAGACACAAACAAAATAGAGGAATTCTACCAAAAATTACAAAGTACTGTTGATACAGCTCACAAAAATTTAATAATAATGGGTGATTTTAATGGACAAATTGGGGAATGTCGTAGTGGCGAAGAGTACATTGTAGGAAGATATGGCAATGGCAATAGGAGCAAAAACGGACAACATTTGGTTAACTTCGGTTTAGAAAACAAACTAAGTATCTTGAATAGTTTCTTTAAAAAGAAAAAGAATAAGAAATGGACGTGGACCTCCCCAAATGGACTCTTTAAAAATGAAATCGACTACATTATGACCAATAAACCAAAAGTTTTTAAAGATCTATCAGTTTTACATAATTTAAATTTTAATTCGGACCATAAAATGATACGTGCAACGTTACGAGCGTCACATACAAAGAAAAGTCGAAGGCTGCAAACTGGATTGACTCCCTATGTGGACATTAAAAATAACTTAGAGATAATGAACAATTTAAAAGAATTTCTAGAGAGAAGAGAACAAAAGGAATACAATAAAACAATTGAGGCGACATACTGCTATTTTGTAAATACTCTCAAAACTGTTGCTCGAAAAGTGTCTACAAATAATAAATCCATACTATCTACCGAAACTATTATATTACTTAAAGAAAGAAAATTGCTTTTACAAGGCAATAAAGACAAAGAAACACGAAAAGAGATCGCAGAAATAAGTAAAAATATCAACAAAAATATCAGGAAAGACAGAAAACAAAAAAGGGCAAATACTTTCCAATATCATATTAAGAAAACAGGCGGAGTGAAGAAAACGTTTAAAGAACTAGAATCGAAAAAGAATTGGATGCCAAATATTAAGGACAGACAAGGAAGAAGTAATACAAAAAGATCAGAAATATTAAATATTGCTACGCAATACTATAAGGAGTTGTACACAAGCAAAAATGAAAAACCTGCCACGACTACGACAGAAGACATGCAAGATATTGAACCTATACCACCTATTCTAAAAGAAGAAACAGAAAGAGCTATCACTACGCAGAAGTTAGGAAAAGCGCCCGGTCTTGATCAAATTACCAATGAACTTCTCAAAACATTCATGCCGGCAATAGTCCCTAAACTAACCAATTTGTTTAACGAAATAATAACAGCAGAAGTCATCCCAGAAGACTGGGTGAGATCAGTGATAGTTTTGTTGCACAAAAAAGGAGACAAAAGAGACATTAACAATTATAGGCCAATAAGCTTAATGTCTAATATATACAAGATCTTTTCTAAAATACTATTGTTTAGACTAACTATTACCCTTGACGAAAACCAGCCAAAAGAGCAAGCTGGATTTAGGAGCAATTTCTCGACCATTGATCACATACACGTCCTACGCCAGATACTTCAGAAATATAGAGAATACAACAAAACATATTATTTGGGTTTTGTAGATTTCAACAAGGCGTTTGATTCCTTGGAACACCACTACATATGGGAATCATTAGAACAACAAGGGGTCCATAAAAAGTACATACGTATCCTAAAAAATATTTATGGGAAAAGCACAGCACAAATAAAACTTGAAAAATTAGGTGAAGAGTTCCCAATAGAAAGAGGCGTCCGTCAAGGTGATCCTATTTCGCCGAAAATATTCTCAGCAGTGTTGGAGTTGATCTTTAGGAAACTGGATTGGGATAATTTCGGACTTAACGTGAACGGAGACAAACTCAGTCATTTGAGATTTGCTGATGATTTAATACTTTTCTCCGAATGCCCGATGATTTTGGAAAGAATGCTACAACAATTAGCAGATGAAAGTGCAAATGCAGGGCTTACTATGAATATAACAAAGACAAAAGTAATGAGCAATTCCTCACAAAAAAACGCTATTGCAGTTAACAATCAAGAGTTAGAATACGTAAGTGAATACGTTTATCTGGGCCAATTAGTATCACCGACAGAGAGCATGCAGAAAGAAATAGAAAGAAGAATAGCAAACACTTGGAAGAAATTTTGGTCATTGAGTGAAGTAATGAAAAATAAGGAAATGCCTATGGCGGAGAAACGAAAAGTCTTCAATGTTTGCATACTGCCATGTCTTACATACGGATGCCAGACATGGGCCTTAACTGAAAAACAACAAAATAAATTGAATATATGTCAGAATGGGATAGAGAGAAGCGTATTGGGAGTAAGAAGAAGGGATAAAATAGAACTAAAAAAGATCAAAGGAGAGACTAAATTTGGAAAAGTTCAATCAATATGCAGAAAATTAAAATGGCGCTGGACGGGACATATGATGAGAGAAAAGAAAGAAAAATGGACCAGAATAATAACGGAATGGTACCCTAGAGAAAACAAAAGAATCAGAGGAAGACAGCCGAAGCGATGGGAAGACGACTTGAAGCAAGTAGCTGGGCCAGAATGGTTACGTACAGCAAAGGACAGAAGCAAATGGAAATCCTTAGAGGAGGCCTTTGTCGAAAGACAAGCTGTTAAGAGGAGAGATAAGCCGAATGCCGAGATATGTTTTAGTATAAGTTAA
Protein
MGEGIEDHGKYILHYKGETPGQYGVGFLIKRKYMDRIEELKGISERIAILNIKFPVQNSRDELWSIIQVYSPTEADKKQDTNKIEEFYQKLQSTVDTAHKNLIIMGDFNGQIGECRSGEEYIVGRYGNGNRSKNGQHLVNFGLENKLSILNSFFKKKKNKKWTWTSPNGLFKNEIDYIMTNKPKVFKDLSVLHNLNFNSDHKMIRATLRASHTKKSRRLQTGLTPYVDIKNNLEIMNNLKEFLERREQKEYNKTIEATYCYFVNTLKTVARKVSTNNKSILSTETIILLKERKLLLQGNKDKETRKEIAEISKNINKNIRKDRKQKRANTFQYHIKKTGGVKKTFKELESKKNWMPNIKDRQGRSNTKRSEILNIATQYYKELYTSKNEKPATTTTEDMQDIEPIPPILKEETERAITTQKLGKAPGLDQITNELLKTFMPAIVPKLTNLFNEIITAEVIPEDWVRSVIVLLHKKGDKRDINNYRPISLMSNIYKIFSKILLFRLTITLDENQPKEQAGFRSNFSTIDHIHVLRQILQKYREYNKTYYLGFVDFNKAFDSLEHHYIWESLEQQGVHKKYIRILKNIYGKSTAQIKLEKLGEEFPIERGVRQGDPISPKIFSAVLELIFRKLDWDNFGLNVNGDKLSHLRFADDLILFSECPMILERMLQQLADESANAGLTMNITKTKVMSNSSQKNAIAVNNQELEYVSEYVYLGQLVSPTESMQKEIERRIANTWKKFWSLSEVMKNKEMPMAEKRKVFNVCILPCLTYGCQTWALTEKQQNKLNICQNGIERSVLGVRRRDKIELKKIKGETKFGKVQSICRKLKWRWTGHMMREKKEKWTRIITEWYPRENKRIRGRQPKRWEDDLKQVAGPEWLRTAKDRSKWKSLEEAFVERQAVKRRDKPNAEICFSIS

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
FJ265561    ADI61829.1    FJ265564    ADI61832.1    FJ265563    ADI61831.1    + More
FJ265562    ADI61830.1    GBBI01004876    JAC13836.1    GBGD01000380    JAC88509.1    ODYU01008249    SOQ51673.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    FJ265544    ADI61812.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265543    ADI61811.1    FJ265545    ADI61813.1    FJ265551    ADI61819.1    JARK01001655    EYB84321.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01000460    EYC36749.1    JARK01001340    EYC30828.1    JARK01001621    EYB86109.1    JARK01001626    EYB85833.1    JARK01001354    EYC21986.1    JARK01001348    EYC25048.1    EYC25050.1    JARK01000388    EYC37469.1    JARK01000173    EYC41342.1    JARK01001389    EYC11015.1    JARK01001370    EYC16150.1    JARK01001639    EYB85201.1    EYC25046.1    JARK01001473    EYB97806.1    EYC25049.1    JARK01001568    EYB89432.1    JARK01000347    EYC38051.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    DS268591    EFO92565.1    EYC25145.1    DS268444    EFP01729.1    GL379822    EGT48339.1    GBBI01004877    JAC13835.1    GDKW01001596    JAI54999.1    JARK01001424    EYC04316.1    EYC04314.1    EYC04317.1    EYC04315.1    QFQQ01000179    PZR20596.1    GBGD01000453    JAC88436.1    JARK01001475    EYB97550.1    JARK01001531    EYB92324.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    EYB98944.1    EYB98081.1    EYC40601.1    JARK01001346    EYC26445.1    JARK01000109    EYC42952.1    EYC33297.1    JARK01000063    EYC44387.1    JARK01001502    EYB94855.1    JARK01001365    EYC18010.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00211   Guanylate_cyc
PF07714   Pkinase_Tyr
PF01094   ANF_receptor
PF03372   Exo_endo_phos
PF00069   Pkinase
PF00201   UDPGT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR029052   Metallo-depent_PP-like       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR001170   ANPR/GUC       
IPR011009   Kinase-like_dom_sf       
IPR028082   Peripla_BP_I       
IPR001054   A/G_cyclase       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR008271   Ser/Thr_kinase_AS       
IPR017441   Protein_kinase_ATP_BS       
IPR002213   UDP_glucos_trans       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
SSF53822   SSF53822       
SSF55073   SSF55073       
Gene 3D
PDB
6AR3     E-value=0.0816039,     Score=87

Ontologies

Topology

Length:
916
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01131
Exp number, first 60 AAs:
0.00128
Total prob of N-in:
0.00010
outside
1  -  916
 
 

Population Genetic Test Statistics

Pi
33.059815
Theta
40.205801
Tajima's D
-1.256107
CLR
0
CSRT
0.0973451327433628
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号