SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04734
Pre Gene Modal
BGIBMGA009865
Annotation
PREDICTED:_atrial_natriuretic_peptide_receptor_2-like_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
PlasmaMembrane   Reliability : 2.479
 

Sequence

CDS
ATGAAGTCTGCCAGGCGTTCTGTGCTCCTGTACGCGGGTGTTTTAGTCACTGTACTCATCACGTCGGCTGTGCCCTTACTGCTTCTCAGACACGTGGTTTCAACGTTAGAGACATTCACCCACTCATTAAACATGAGTACGGAGAAATTGATAGCCGAGAAACAGAAGAGCGACCTCTTGCTCTCCCGGATGCTCCCGCTGCCAGTTCTGCGGAGGCTGCGGGCACAGAGGACGGTGCCGGCTGAAGCCTTCGACGCGGTCACCATCTTCTTCAGCGATATTGTCGGCTTCACCACCATATCTGCGAATAGCACGCCCATGGAAGTCATCAACATGCTGAACATGCTCTATAAATTGTTTGACGAGAAAATATCTCAATACAACGTTTACAAGGTGGAAACTATAGGAGACGCGTATATGGTGGTCTCTGGTCTGCCACAGAAGAACGGCAGCCGTCACGCGTCCGAGATAGCTGACATGTCATTGTCACTGGTGAGCAGCGTGGAGGAGGCGCGGGTACCGCACCGTCCCGCCGTGCCTCTACGAGTGCGGGCCGGTGTCAACACGGGCCCGTGCGTCGCCGGCGTGGTCGGGACCACCATGCCGAGATACTGCCTTTTTGGCGACACCATCAACACCGCCAGCAGAATGGAGTCTACTGGCGAACCTATGAAAATTCACATCTCGGATTCGACGAAGAGAGCCTTAGACGAGTTCGGTACCTATATCACTGAGTCCAGAGGAATTATTGATATTCCGGGCAAAGGCAGCATGGAAACGTTCTGGTTGCTCGACAAGATCGGAGGAGTACAAAGTGAGAGTCCGCGGTGTCAATTCAACGACTACGACCACAATTTACTGGAACTCATAATTAAATCTTAA
Protein
MKSARRSVLLYAGVLVTVLITSAVPLLLLRHVVSTLETFTHSLNMSTEKLIAEKQKSDLLLSRMLPLPVLRRLRAQRTVPAEAFDAVTIFFSDIVGFTTISANSTPMEVINMLNMLYKLFDEKISQYNVYKVETIGDAYMVVSGLPQKNGSRHASEIADMSLSLVSSVEEARVPHRPAVPLRVRAGVNTGPCVAGVVGTTMPRYCLFGDTINTASRMESTGEPMKIHISDSTKRALDEFGTYITESRGIIDIPGKGSMETFWLLDKIGGVQSESPRCQFNDYDHNLLELIIKS

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the adenylyl cyclase class-4/guanylyl cyclase family.
EC Number
4.6.1.2
EMBL
BABH01026556    BABH01026557    KQ459595    KPI95714.1    KQ459784    KPJ19950.1    + More
AGBW02012140    OWR45574.1    ODYU01010978    SOQ56430.1    JTDY01001316    KOB74222.1    LJIJ01000028    ODN05186.1    GDIP01173931    JAJ49471.1    GDIQ01149084    JAL02642.1    GDIQ01008120    JAN86617.1    GDIP01030400    JAM73315.1    AAAB01008898    EAA09176.4    AXCM01000458    ATLV01026914    KE525420    KFB53632.1    ODYU01003514    SOQ42404.1    CH477318    EAT43691.1    APCN01005408    AXCN02001201    AGBW02009004    OWR51884.1    ADMH02001458    ETN62492.1    KK853042    KDR12137.1    KK855717    PTY23639.1    KPJ19949.1    LRGB01002190    KZS08548.1    ACPB03017284    NEVH01025135    PNF15831.1    LJIJ01000914    ODM93786.1    GL732550    EFX79739.1    NWSH01001513    PCG71011.1    DS231898    EDS44630.1    GECU01031150    JAS76556.1    EAT43692.1    GEBQ01001932    JAT38045.1    KL217800    KFO98866.1    DS233064    EDS27829.1    MUJZ01002637    OTF83670.1    EAA09177.5    KB630856    KB631023    ERL83905.1    ERL84012.1    ADON01084214    KDR12136.1    GL888520    EGI59866.1    ADTU01016189    ADTU01016190    HACA01008788    CDW26149.1    CH940648    EDW62204.2    GBYB01005079    JAG74846.1    KK390609    KFV54421.1    CAQQ02031877    CAQQ02031878    CAQQ02031879    KK937289    KFQ47905.1    GBFC01000092    JAC59246.1    KK838640    KFP81628.1    KB030846    ELK09022.1    KQ971362    KYB25768.1    BC023420    AAH23420.1    GBXM01012325    JAH96252.1    KL672239    KFW85011.1    KL438435    KFW93530.1    KL484857    KFO09243.1    AFYH01074404    AFYH01074405    AKCR02000044    PKK24170.1    LNIX01000003    OXA58781.1    CH933808    EDW08729.1    QUSF01000077    RLV95590.1    KL525367    KFO90995.1    KK502299    KFP22284.1    KK804800    KFQ31346.1    KK733826    KFR00129.1    LMAW01000094    KQL60805.1    JR050741    AEY61347.1    CP026253    AWP09399.1    GAIX01005808    JAA86752.1    KL266973    KFZ62278.1    GL447857    EFN85810.1    AGCU01118388    AGCU01118389    LJIJ01000057    ODN04011.1    GALX01001646    JAB66820.1    DS235366    EEB15293.1   
Pfam
PF00211   Guanylate_cyc        + More
PF08376   NIT
PF07701   HNOBA
PF07714   Pkinase_Tyr
Interpro
IPR018297   A/G_cyclase_CS        + More
IPR029787   Nucleotide_cyclase       
IPR001054   A/G_cyclase       
IPR013587   Nitrate/nitrite_sensing       
IPR011645   HNOB_dom_associated       
IPR011009   Kinase-like_dom_sf       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR000719   Prot_kinase_dom       
SUPFAM
SSF55073   SSF55073        + More
SSF56112   SSF56112       
Gene 3D
PDB
3ET6     E-value=1.10746e-39,     Score=409

Ontologies

Topology

Length:
293
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.95196
Exp number, first 60 AAs:
22.80617
Total prob of N-in:
0.99864
POSSIBLE N-term signal
sequence
inside
1  -  6
TMhelix
7  -  29
outside
30  -  293
 
 

Population Genetic Test Statistics

Pi
237.296826
Theta
187.428231
Tajima's D
0.68449
CLR
0
CSRT
0.569121543922804
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号