SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04732
Pre Gene Modal
BGIBMGA009867
Annotation
PREDICTED:_guanylate_cyclase_receptor-type_gcy-1_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.494
 

Sequence

CDS
ATGTCATGCAGCATTTTCATACCATCTCCCAGCCGGAAGCCGGAGAAGTCTGAAGCATGGAGCTTAAAGGTGCGAAGGTGGTGCCGAAGTCGCCGTTGTCAGCTCTGGCGACTGTTGCTGCTGCCCTTTATTCCGATCCTAGCACTCATCATACAGACTACGCTCTCCCTGCGGCACAGCATCACAAATGGAAGAGATGTCGCTGATGTTGAAGAACAGGTCAGTCGGGCCACGGAGCTGGGCAAGCTCGTGACGAGGCTGCAGCAGGAACGCTCCGAAGTAGCCTTCTTCATCTTCACTAATGGAAGTAAATTGAGGTCAAATCTAACGCAACGGTACGTGAGAACCGACATGGCAGTTCAGAAGATGGGCGATCTTCCGGTGCTGATGTTCAAGAATCGCACGAGGCCCGTTGACGGAGCTACGTTTCAAACTGAACTCACCGAGTTGAGAGCCAGCATCAACGCCGAGAAGTCAATGACCGAGGCTGTGGAGTGGTACACGAACGCGAACGCCGCCCTCCTCCATCATCTGACGAAGGAAATTAAGGACACAGACAGCAGCACTCTTTGGAGGTACCTGGTCGGATTCAAGAATCTTCTGCGCAGCATCGAGTGTAAGGGTATTGCTTCGGTTTTGGGCATCAACTATTTCGCAAGAGGGTATCTGCAAGCGAAAGCATACGAAAGATACGTGGCTCATATGACGTTAGGTAGAGATCTACTCGACAATACTCTGAACTTGGTGCCTTCTTTGATACCGCTTCATAAAGACATTAAAGAAGACAGCCCGGAATACCAAGATTTAGAGAAAAAGAATCAGCAAATAGTTGATAACAAGCATCAAGAAGGGAGTGTCGCTGAAGCTATAGAGTACTTCGATCAGACGGCTACATTTCTGGATAAGCTGAGGGCTGTACAGAAACAACTCCGAGAATATATCAGGGAAGGTGCAACGGAGAGTTTGAAAGACGCAAGGCAAAGCGAAGCGATTTGCGCTGGTATACTCGTACTGGTCTGCGTTGTTTCACCCATTATAATTGCATTGGTCAGAAACGCTGTCAACACTATACAGGTATATGCGAGAAATTTATCAGAGAAAGCAAGAGAACTGGAGCACGAAAAGGAACTTAGCGACTCACTATTGTATCAAATGCTTCCACCGAGCGTCGCTAAACAATTGAAACAAACACAACAGGTACCCGCAGAGTTTTTCGCCTCTGTGACCGTATATTTCAGCGACATAGTGGGCTTTACAGCCATTGCAGCTGTGTCTACACCTTATCAAGTGATCAGTTTCTTGAACTCCGTTTACAAGTTGTTCGACGAAAGGATTGAATGTTACGACGTATACAAGATTGAGACCATTGGTGACTCTTACATGGTGGCGTCCGGGATACCGGTTAGGAATGGTAATAAGCACGCGTCCGAGATAGCCAGTATGGCGCTGGAGCTGCTGGAAGCGACATCAATGTGTCGTCTACCGCATCGGCCCGATCAGACTTTATGCATGAGAAGCGGTATTCACACCGGTCCCTGTGTGGCTGGGATTGTGGGCAGTAAGATGCCTCGGTACTGTCTATTCGGAGACACCATTAACACGGCCAGTCGCATGGAAAGCACCGGAGAACCCATGAAGATTCAAATTTCTGAAGACGTCAAAAGGGAAATAGATAAAACCGGTCTCTTCATCACGACCCCGAGAGGAGTTGTAGATGTGAAGGGTAAAGGTGAAATGACGACTCATTGGCTGGAGGGGCGCCGGCCGGGGTCCCGCACGCCGCTCTCCCTAGCTCCAACACACCCGCAGACACGCTCCTCGCCAAGATACAAACACGACAAGATATTTCATTACTAG
Protein
MSCSIFIPSPSRKPEKSEAWSLKVRRWCRSRRCQLWRLLLLPFIPILALIIQTTLSLRHSITNGRDVADVEEQVSRATELGKLVTRLQQERSEVAFFIFTNGSKLRSNLTQRYVRTDMAVQKMGDLPVLMFKNRTRPVDGATFQTELTELRASINAEKSMTEAVEWYTNANAALLHHLTKEIKDTDSSTLWRYLVGFKNLLRSIECKGIASVLGINYFARGYLQAKAYERYVAHMTLGRDLLDNTLNLVPSLIPLHKDIKEDSPEYQDLEKKNQQIVDNKHQEGSVAEAIEYFDQTATFLDKLRAVQKQLREYIREGATESLKDARQSEAICAGILVLVCVVSPIIIALVRNAVNTIQVYARNLSEKARELEHEKELSDSLLYQMLPPSVAKQLKQTQQVPAEFFASVTVYFSDIVGFTAIAAVSTPYQVISFLNSVYKLFDERIECYDVYKIETIGDSYMVASGIPVRNGNKHASEIASMALELLEATSMCRLPHRPDQTLCMRSGIHTGPCVAGIVGSKMPRYCLFGDTINTASRMESTGEPMKIQISEDVKREIDKTGLFITTPRGVVDVKGKGEMTTHWLEGRRPGSRTPLSLAPTHPQTRSSPRYKHDKIFHY

Summary

Similarity
Belongs to the adenylyl cyclase class-4/guanylyl cyclase family.
EMBL
KQ459784    KPJ19949.1    KQ459595    KPI95713.1    AGBW02009004    OWR51884.1    + More
NWSH01001513    PCG71011.1    JR050741    AEY61347.1    KQ764717    OAD54421.1    KQ414643    KOC66668.1    KK853042    KDR12136.1    ADTU01016189    ADTU01016190    KQ976456    KYM84881.1    KQ435848    KOX70985.1    GL888520    EGI59866.1    GBYB01005079    JAG74846.1    KQ981763    KYN36048.1    KQ978957    KYN27141.1    KQ983039    KYQ48056.1    KK107341    EZA52416.1    KQ977622    KYN01264.1    JRES01000655    KNC29576.1    GL447857    EFN85810.1    CH940648    EDW62204.2    JXJN01024057    KQ971362    KYB25768.1    CCAG010017210    ACPB03017284    KB630856    KB631023    ERL83905.1    ERL84012.1    AAAB01008898    EAA09177.5    CH964282    EDW85764.2    CH933808    EDW08729.1    DS233064    EDS27829.1    AE013599    BT099990    AAF57725.2    ACX54874.1    KQ434809    KZC06433.1    BT025905    ABG02149.1    CH916367    EDW01836.1    CH477318    EAT43692.1    GEZM01052618    JAV74386.1    GEZM01052617    JAV74387.1    CH902619    EDV36061.1    APCN01005408    CH480816    EDW48421.1    CM000362    CM002911    EDX07631.1    KMY94790.1    CM000071    EDY69210.2    KRT02636.1    KRT02637.1    KRT02638.1    KRT02639.1    KRT02641.1    KRT02642.1    KRT02643.1    KRT02644.1    OUUW01000001    SPP75897.1    CH954179    EDV55037.1    GEBQ01001932    JAT38045.1    CM000158    EDW91669.1    CH479183    EDW36367.1    QOIP01000012    RLU16322.1    KRT02640.1    DS235867    EEB19418.1    GECU01031150    JAS76556.1    LJIJ01000914    ODM93786.1    CVRI01000004    CRK87152.1    CVRI01000011    CRK89249.1    CP012524    ALC40437.1    ALC41375.1    KZ288379    PBC26595.1    APGK01035752    KB740928    KB630163    ENN77945.1    ERL83443.1    CVRI01000043    CRK95793.1    LNIX01000003    OXA57491.1    OXA58254.1    ADMH02001458    ETN62493.1    HACA01008788    CDW26149.1    GL435556    EFN73158.1    LJIJ01000057    ODN04011.1    AXCM01000457    GDIQ01008120    JAN86617.1    GDIP01030400    JAM73315.1    NEVH01025135    PNF15831.1    LRGB01002190    KZS08548.1    KDR12137.1    AXCM01000458    EAA09176.4    ATLV01026914    KE525420    KFB53632.1   
Pfam
PF08376   NIT        + More
PF00211   Guanylate_cyc
PF07701   HNOBA
PF10277   Frag1
Interpro
IPR018297   A/G_cyclase_CS        + More
IPR001054   A/G_cyclase       
IPR011645   HNOB_dom_associated       
IPR029787   Nucleotide_cyclase       
IPR013587   Nitrate/nitrite_sensing       
IPR009050   Globin-like_sf       
IPR019402   Frag1/DRAM/Sfk1       
SUPFAM
SSF55073   SSF55073        + More
SSF46458   SSF46458       
Gene 3D
PDB
5O5L     E-value=5.38466e-38,     Score=398

Ontologies

Topology

Length:
618
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
62.79912
Exp number, first 60 AAs:
21.23305
Total prob of N-in:
0.96793
POSSIBLE N-term signal
sequence
inside
1  -  34
TMhelix
35  -  57
outside
58  -  330
TMhelix
331  -  353
inside
354  -  403
TMhelix
404  -  426
outside
427  -  618
 
 

Population Genetic Test Statistics

Pi
226.746422
Theta
160.36144
Tajima's D
1.147609
CLR
0.168329
CSRT
0.702464876756162
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号