SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04727
Pre Gene Modal
BGIBMGA012813
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.012
 

Sequence

CDS
ATGGATGGAAGGCCAAACGTACGGAAGCTTGCTGAGCCCGACACACGAGCGAAGACCCACACCGCTATTAATCAATGGGCCAACGATCGTCGCACTGAAACCACTGCCTCTGACCTCGACACGTGGACTAGTCTAAAGCGAAGTGTAAAAGATATATGTCACCAATACCTCCAACCATCACAACTGGTCAAAAAACAAGATTGGATGACAGATTCAATTTTGCAGCTTATGGAAGACAGGAGGCAATTTAAGGGTACAAATCCAGTAATGTATAAGCAAATCGATGTCACCATTCGAAAAGAGATTGCGAAAGCCAAGAATGATTACTACAGCAATAAGTGCGCGCACTTGGAAGATCTCCTTCGTAAACATGACAGCTTCAATGCGCACAAGCACATCAAGGAAATGGTTGGTCATAGACGGAAATCAATGAATACTCTGACCGATGCAGGTGGTAACCTCATTCTTGACACCGATGGCAAAAAGAGAGTGTGGTGTGACTATGTTGCAGAGATGTTTGCGGACTCATCGAGGAACATTTCACCGATCACTGATCGGACTGGTCCAGCTATGTTGCGATCTGAGGTTTTGCGGGCCTTGAAAGCTGCTAAAACAGGTAAATCACCGGGTCCTGATAATATACCGATCGAAATACTAAAGTTGCTGGAAGAAGATCAACTGGACGTTCTCACACAGTTCTTCAACAACATCTACGAAACAGGCAATCTTCCTAGTGACTGGCTAAAATCCACATTCATCACGATACCCAAGAAGCAAAATGCCAAAAAATGTGGAGAGTATCGTATGATTAGTCTAATGAGCCATGTCCTAAAAGTATTCTTGAACATCATACAGAATAGAATACGGCCAAAATGTGATGAACAACTGGGCGATAGCCAATTTGGATTTCGATCTGGTGTTGGCACCAGAGAAGCTCTTTTCGCTCTCAACGTTCTCGTACAGAAATGCAGAGACATGCAAACTGATGTCTTTTTGTGCTTCATAGACTACGAAAAGGCATTTGACCGAGTTAAACATCACCAACTTTTTAGCCTTTTATGTGACATTGGTCTAGATGGTAAGGACGTCAGAATCATCCGCAACCTGTACGAGAAGCAGGTGGCTACGATAAGAGTCGAAAACGAGGAAACCGACCAAGTTGAGATCTGTCGTGGGGTCCGGCAGGGGTGTGTCTTATCCCCGTTGCTTTTTAACATCTACTCAGAGGCTGTGATGTCAAAAGCTCTTGAAAATCTTGAAGTGGGAATAGGAATCAACGGCAGGGTCGTTAACAACTTGCGTTATGCGGACGACACTATCCTTATTGCAGCATCGGAAGCCGATTTGCAAGCAATTGTGAATAAGGTTAATGAGTGCAGCGAAGAAGCCGGGTTGTCGATAAACATAAGCAAGACCAAGTTCACGGTAGTCTCAAGAAACCCGGATTTGAGTTCAAGCGTATCTGTAGCTGGGAAACAACTAGAGCGGGTACGACAGTACAAGTATTTAGGGGCTTGGGTAAACGAAGCATGGGAATCTGATCAAGAAATCAAGACCCGGATAGAAACTGCTCGAGCCTCTTTTAATAAAATGAGGAAAGTTCTTTGCTGTCGTCAACTGAATATAAAGCTCCGAGTCAGGCTACTCATGTGCTATATCTGGCCTATCGTCATGTATGGTTGCGAAACGTGGACCCTGAAAGAGGATACTACAAGACGCCTACAGGCATTCGAGATGTGGTGCTACCGTCGCATGTTACGCATTGCAGATGTACTCCTGGCCAAGACGAACCACAGACTGAAAAATATGGCGCAAAATCAGTATATTTTACACGACGCAATGAAAAAATATGGTTAG
Protein
MDGRPNVRKLAEPDTRAKTHTAINQWANDRRTETTASDLDTWTSLKRSVKDICHQYLQPSQLVKKQDWMTDSILQLMEDRRQFKGTNPVMYKQIDVTIRKEIAKAKNDYYSNKCAHLEDLLRKHDSFNAHKHIKEMVGHRRKSMNTLTDAGGNLILDTDGKKRVWCDYVAEMFADSSRNISPITDRTGPAMLRSEVLRALKAAKTGKSPGPDNIPIEILKLLEEDQLDVLTQFFNNIYETGNLPSDWLKSTFITIPKKQNAKKCGEYRMISLMSHVLKVFLNIIQNRIRPKCDEQLGDSQFGFRSGVGTREALFALNVLVQKCRDMQTDVFLCFIDYEKAFDRVKHHQLFSLLCDIGLDGKDVRIIRNLYEKQVATIRVENEETDQVEICRGVRQGCVLSPLLFNIYSEAVMSKALENLEVGIGINGRVVNNLRYADDTILIAASEADLQAIVNKVNECSEEAGLSINISKTKFTVVSRNPDLSSSVSVAGKQLERVRQYKYLGAWVNEAWESDQEIKTRIETARASFNKMRKVLCCRQLNIKLRVRLLMCYIWPIVMYGCETWTLKEDTTRRLQAFEMWCYRRMLRIADVLLAKTNHRLKNMAQNQYILHDAMKKYG

Summary

EMBL
GU815089    ADF18552.1    NWSH01001998    PCG69477.1    LBMM01001656    KMQ95932.1    + More
GGMS01004979    MBY74182.1    RQTK01000700    RUS75926.1    BDSA01000081    GBE63537.1    NEVH01002690    PNF41636.1    NEVH01025130    PNF15934.1    NEVH01002150    PNF42436.1    NEVH01013208    PNF29772.1    NEVH01024952    PNF16338.1    NEVH01007822    PNF35313.1    NEVH01006981    PNF36299.1    NEVH01006734    PNF36732.1    NEVH01013241    PNF29590.1    NEVH01006936    PNF36357.1    NEVH01012083    PNF30919.1    NEVH01007402    PNF35873.1    NEVH01002684    PNF41680.1    NEVH01000609    PNF43402.1    PNF16321.1    NEVH01026085    PNF14968.1    NEVH01012564    PNF30212.1    NEVH01020333    PNF21790.1    NEVH01005896    PNF38212.1    NEVH01027104    PNF13657.1    PNF38208.1    NEVH01011205    PNF31711.1    NEVH01017540    PNF24056.1    NEVH01020851    NEVH01013954    NEVH01006574    NEVH01001358    NEVH01001354    PNF21237.1    PNF28332.1    PNF37782.1    PNF42792.1    PNF42884.1    NEVH01027067    PNF13944.1    PNF37787.1    NEVH01022636    PNF18588.1    NEVH01024428    NEVH01017533    NEVH01016946    NEVH01015820    NEVH01015300    NEVH01013960    NEVH01010478    NEVH01010477    NEVH01006721    NEVH01005894    NEVH01003749    NEVH01003737    NEVH01000598    PNF17088.1    PNF24133.1    PNF25000.1    PNF26655.1    PNF27272.1    PNF28247.1    PNF32492.1    PNF32520.1    PNF37274.1    PNF38220.1    PNF40102.1    PNF40402.1    PNF43530.1    NEVH01013563    PNF28562.1    NEVH01016289    PNF26277.1    NEVH01015309    PNF27009.1    NEVH01005906    PNF38146.1    NEVH01005889    PNF38332.1    NEVH01019075    PNF22938.1    NEVH01020850    PNF21258.1    NEVH01019077    PNF22889.1    NEVH01020940    PNF20478.1    NEVH01021921    PNF19488.1    PNF37211.1    PNF37310.1    NEVH01011186    PNF32183.1    NEVH01016335    PNF25462.1    PNF37115.1    NEVH01013553    PNF28765.1    NEVH01013215    PNF29703.1    NEVH01013959    PNF28275.1    NEVH01017460    PNF24248.1    NEVH01003500    PNF40666.1    NEVH01023953    PNF17877.1    NEVH01020867    PNF20816.1    NEVH01005277    PNF39212.1    NEVH01019066    PNF23173.1    PNF26276.1    NEVH01014359    PNF27813.1    NEVH01021219    PNF19787.1    NEVH01012082    PNF31006.1    NEVH01020937    PNF20581.1    NEVH01020865    PNF20863.1    NEVH01002700    PNF41535.1    GFAH01000222    JAV48167.1    PNF21767.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    GGMR01018096    MBY30715.1    PNF41704.1    NEVH01023985    PNF17546.1    PNF22955.1    NEVH01017570    PNF23798.1    NEVH01002141    PNF42599.1    QIAP01000240    PYX61602.1    PNF27789.1    NEVH01003750    PNF40091.1    NEVH01017443    PNF24485.1    NEVH01017534    PNF24114.1    NEVH01019971    PNF22037.1    NEVH01011898    PNF31156.1    NEVH01014358    PNF27914.1    NEVH01013275    PNF29009.1    PNF35815.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01019064    PNF23230.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01025135    PNF15828.1    NEVH01021221    PNF19729.1    NEVH01007834    PNF34995.1    NEVH01011217    PNF31657.1    NEVH01017541    NEVH01006570    NEVH01001345    PNF24053.1    PNF37832.1    PNF42982.1    NEVH01019964    PNF22170.1    NEVH01009090    PNF33636.1    NEVH01002994    PNF40909.1    NEVH01000618    PNF43201.1    NEVH01017543    PNF23975.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
5HHL     E-value=3.78979e-12,     Score=175

Ontologies

Topology

Length:
618
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.589349999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00320
outside
1  -  618
 
 

Population Genetic Test Statistics

Pi
305.98632
Theta
154.448114
Tajima's D
2.163007
CLR
56.359699
CSRT
0.906054697265137
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号