SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04706
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 1.702
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCAGCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGTGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAATGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTGCACCGGCTCACGGAGCACATTCTTGTGGGGCTTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEAAVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRVYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVECRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGAPAHGAHSCGA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    ABLF02022418    GBBI01004395    JAC14317.1    GEBQ01004157    JAT35820.1    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GALX01005299    JAB63167.1    ABLF02065839    KQ971729    KYB24751.1    GGMR01018716    MBY31335.1    KK115285    KFM64681.1    GGMR01004661    MBY17280.1    ABLF02008153    ABLF02008462    ABLF02008464    KK118005    KFM71947.1    GGMR01015412    MBY28031.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GFTR01008262    JAW08164.1    KK113281    KFM59799.1    GGMR01016297    MBY28916.1    KK119261    KFM75202.1    GFTR01008279    JAW08147.1    ABLF02042385    GFTR01008256    JAW08170.1    GALX01005359    JAB63107.1    GEDC01029594    JAS07704.1    GGMS01006655    MBY75858.1    GFTR01008271    JAW08155.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    ABLF02034467    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    ABLF02007779    ABLF02007782    ABLF02050375    GFTR01008251    JAW08175.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GGFK01009732    MBW43053.1    GGMR01013409    MBY26028.1    GGFK01009846    MBW43167.1    ABLF02041767    GFTR01008261    JAW08165.1    GGMS01002992    MBY72195.1    KK119069    KFM74603.1    GGMR01002322    MBY14941.1    ABLF02037436    ABLF02024246    GFTR01008260    JAW08166.1    GGMR01000226    MBY12845.1    ABLF02028535    ABLF02028545    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    LBMM01014024    KMQ85369.1    ABLF02037715    ABLF02012584    ABLF02013765    ABLF02024884    GFTR01007929    JAW08497.1    GGMR01012189    MBY24808.1    GGMS01014910    MBY84113.1    KB632143    ERL89075.1    GEZM01084970    JAV60359.1    GFTR01008257    JAW08169.1    NEVH01023280    PNF18085.1    GBBI01003811    JAC14901.1    GEZM01084969    JAV60363.1    GGMR01012443    MBY25062.1    ABLF02042518    ABLF02057746    GEZM01021881    JAV88842.1    ABLF02023911    RSAL01000708    RVE41206.1    GGMR01016905    MBY29524.1    GFTR01008151    JAW08275.1    GECL01003538    JAP02586.1    NNAY01003095    OXU19992.1    GBBI01004571    JAC14141.1    GGMS01002786    MBY71989.1    GGMR01006581    MBY19200.1    M22874    M38643    ABLF02040174    ABLF02040183    ABLF02055266    LBMM01018163    KMQ83860.1    GFTR01008169    JAW08257.1    MCIT02004487    PHT96476.1    ABLF02023551    ABLF02023561    KB631961    ERL87484.1    ABLF02001804    ABLF02035179    ABLF02062794    KB632327    ERL92508.1    GGFJ01001844    MBW50985.1    GDKW01003730    JAI52865.1    ABLF02003241    ABLF02003242    ABLF02025904    NEVH01005277    PNF39135.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    NEVH01011985    PNF31054.1    GFTR01008254    JAW08172.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01005923    PNF38085.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF14291   DUF4371
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR025398   DUF4371       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
464
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.76643
Exp number, first 60 AAs:
0.0905
Total prob of N-in:
0.06732
outside
1  -  464
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
221.974912
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号