SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04682
Annotation
PREDICTED:_uncharacterized_protein_LOC106142350_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.06
 

Sequence

CDS
ATGGGCGGTAGCCGTTCAAGACGTGTGCTGGGGAGTAGATCCTATAAAAATTATTCGGCTCAAATGTTAGACACCGCAGTGGATCTGGTAAGCCGCAAAATTATTTCATCTTTAGAGGCATCAAAGCAATTTCTAATTCCCAGAAGAACAATAGACAATAAAGTGAAAAAGAAACACCCAAAAAAGCCAGGAGCTCAGCAACGACTTACTGCTGCCGAAGAACTAGACATAATAAAAGTACTCACCGCGGCAGCAGATTTTGGGTCACCTGTATCGAGATTGGAACTTAGGCTCATCGTCCGCACATACTTGAACAAAAATAATAAGGGGCATTTGTTTAAACACAACCTTCCTGGAAAGTGGTGGGTTAAAAATTTTTTGAACCGCCATAAAGAAATGCTAACAGAAAGAGCCGTGCAAAACATTAAAAGAGTTCGCGCTTCTACTAATACTGATGACTTTGAAAATTATTTTGAAAATTTACGTAAATCTCTTGATAAAATACCGGCTAAAAACATTTTAAATTATGATGAGACTAATCTCTCGGATAATCCTGGTTCAACGAAATGTATTTTTAAACGTAAAGTAAAATATCCGGAACGTATAATGAATACTTCCAAAGGAAATATTTCTATAATGTTTGCTGCGACGGCGGATGGTACTCTGTTACCTACATATACCGTTTATAAGGCTGAGCATTTATGGACAACGTGGTGTGAAAATGGGCCTGGCAAAGCGCGATATAACAGGAGTAAATCTGGTTGGTTCGACTCGACAGTTTTCCAAGACTGGTTTAATTCAGTTATCATACCATGGGCAGACAAACTGGATGGTCCAAAGTTGATTATAGGCGACAATCTTTCAAGCCACCTTAATATTGATATAGTCAGTAAATGTGAAGAACGGAACATAAGATTTACTTTTTTACCACCAAACTCAACTCATATATCCCAACCACTGGATGTGGCATTTTTTGGTCCCTTAAAAAGAAAATGGCGCGATATTTTGACCCAATATAAAATACATAATCCAGCAGAACCTCAAATTAACAAAGCCCACTTCCCCATGTTGTTAAAATCTCTATTAGAGGCTATAGAAATAAATAGTAAAGCAAATATCTGCGCTGGATTTAAGGCAACAGGCATAGTGCCTTTTAATCCCCAAACAATATTACGAAAGATACCCGATTATGAAGAGCAAAACAATTATACAATCGATACCGCGCTCTTAGATTATTTGAAAGCCAATCGTACAGCGAACCCTCTACAAAAATTAAGAAACAAAAAATTAAATATTACTCCAGGTAAGTCTATTTCCTCTCAAGAAGTTCAGTTATTCATGACGAAAAAGAAATCTAAGTTATCTAGAGAAACAAATCGAAGTAACATTAACGAAGCTCAACAAACTTTTCTTGATCTAGAAACGAATCTTGATGCAGAGCCAGTGATCGATGAGCCTAATTCAAAAACCCGACCAAAGGTTACTATTCTTTCAGAAGTCAGATTTAGTCCATATAATTGCGCCTATGCAGATTTGACAAAGATGCTTCCACAGAATCTTAAAAAGGTAGATAAAAGCTACAACATATTCAAATCTGAAAGTAAGGAGAATCTGCCCGTAATTCAACCTGAAGAAGAATTTTTAGAGTACATAGATTACGAAAACCAAATGCCATCAACGTCTGCAGATAATAAAAGGTTGATACTTAAAAAACCGGAGTCATGTAATGCAAAAAAGAAGATAAAGAGAGACAATAGTGACGACAATAGCGAAAATAGTGACAGTTATTCCTTAAGAGATACTTCTGAAGATGAATGTTTTATACCATCGGAATCAGAGTCATGTGAAGATTTTGAAGAACAAAATGTACAAAATACAGTGAAAAAATGTGAAACTCTTCGGATTGATAGTTACGTTTTAGTTAAATTTTGTGGGCCAAAAACCAACAAATACTATGTTGGAAAAGTATTGGATATTATTGATGATTCTGGTATGTATGTTAAATTTATGAGGAACAGAAAGGAAGAATTTTATTGGCCACATATCGATGACATTAGTTATACAGTAAAAAGTGACATCGAAATTATCCTAGGAATCCCTCACGAGGGTCGAAGAGGTACTTTAAGATTTGACTGTATCGACTTTTCAAAGTATAATGTTCAATAA
Protein
MGGSRSRRVLGSRSYKNYSAQMLDTAVDLVSRKIISSLEASKQFLIPRRTIDNKVKKKHPKKPGAQQRLTAAEELDIIKVLTAAADFGSPVSRLELRLIVRTYLNKNNKGHLFKHNLPGKWWVKNFLNRHKEMLTERAVQNIKRVRASTNTDDFENYFENLRKSLDKIPAKNILNYDETNLSDNPGSTKCIFKRKVKYPERIMNTSKGNISIMFAATADGTLLPTYTVYKAEHLWTTWCENGPGKARYNRSKSGWFDSTVFQDWFNSVIIPWADKLDGPKLIIGDNLSSHLNIDIVSKCEERNIRFTFLPPNSTHISQPLDVAFFGPLKRKWRDILTQYKIHNPAEPQINKAHFPMLLKSLLEAIEINSKANICAGFKATGIVPFNPQTILRKIPDYEEQNNYTIDTALLDYLKANRTANPLQKLRNKKLNITPGKSISSQEVQLFMTKKKSKLSRETNRSNINEAQQTFLDLETNLDAEPVIDEPNSKTRPKVTILSEVRFSPYNCAYADLTKMLPQNLKKVDKSYNIFKSESKENLPVIQPEEEFLEYIDYENQMPSTSADNKRLILKKPESCNAKKKIKRDNSDDNSENSDSYSLRDTSEDECFIPSESESCEDFEEQNVQNTVKKCETLRIDSYVLVKFCGPKTNKYYVGKVLDIIDDSGMYVKFMRNRKEEFYWPHIDDISYTVKSDIEIILGIPHEGRRGTLRFDCIDFSKYNVQ

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
721
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0427500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00229
outside
1  -  721
 
 

Population Genetic Test Statistics

Pi
153.038053
Theta
172.810423
Tajima's D
-1.0973
CLR
3.421575
CSRT
0.117494125293735
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号