SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04601
Annotation
PREDICTED:_uncharacterized_protein_LOC105381391_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 4.273
 

Sequence

CDS
ATGTCGAAAATAGAAGAAAAAAACGACGATCTAGACTATTACGACATAGAAAACTCGGATCTTGAACAACCTGATATAGTGACGCTAGTTAAACAAGGCAAACGCACATTTATATACAAGTGTAACAAACAACAACTACAAAATATTCTTGAGAGTGAAAACGTAACTTATAAATCGGAAGCAACACTTGATCAACTACGTAAATTAACGAGTGATTACTATAAATTAAAAGAAACTAACAAAAATAGTGCTCAGTTATCAGCCAACATGTCACTTATATCAAATTTGAAATCCTTTGATGGAGAAAAGTGGTCAGTGTTCCAGGAACAGTTAGACTGTTTCTTTATCGTTAATGAAGTGTCCGATGAAAAAAAAGTACCACTATTAATCACTAAATTAGCACCCAAAGTTTATGAAGTCCTCTCTTATTTATGCAAACCAAAAAAACCACAGGAACTAAAATTTGACCAACTTTGTTTCAAGTTAGCAGCAAAATATGATCAAAAACTACCATCAGCCATTGAAAGAGCAAATTTCAGACAGCGGAACCAGGCACCGAATGAAAAAGTAGAAGATTACGTCTTGGAACTGAGGAAACTTGCTGCAAAATGTAACTTCAAAGATATGGAGGACCAAGTCAAAGAGAAACTAATGGACGGAGTGTTCTCAAAAATGATAAAGTTTGAATTGATGAAGAGTGCTAGTGATGCAACACTAGAAAGGTGTATTGAATTAGCCCGCACTGTTGAAGCAGCAATATTACAAGCAAACGGGGCCACAAATGAAGTTTCGGAAATATTTGTCTACAAATCAACCAATAAAACACCACAACAGCAAAGAAATACCTACCAACAAAAAAATCAATGTTACTGCTGCGGAAAATGGAACCACCTAAAGCGGGACTGCAGACTCAACAGAAAATATTGCTCTGAATGTGGAATTCAAGGACATATCTTCAGAATGTGTCCCAAGAAGCAAAGAAAAGTAAATGTTCTGCAGGAAGATAACCAACAAAAGGATAAAAATACAGATAATGAACCCACTGAGTTTGAACCAAAATATTATGAAACATATGCATGTAACACTGTGAGTAAAATACCACCTTAA
Protein
MSKIEEKNDDLDYYDIENSDLEQPDIVTLVKQGKRTFIYKCNKQQLQNILESENVTYKSEATLDQLRKLTSDYYKLKETNKNSAQLSANMSLISNLKSFDGEKWSVFQEQLDCFFIVNEVSDEKKVPLLITKLAPKVYEVLSYLCKPKKPQELKFDQLCFKLAAKYDQKLPSAIERANFRQRNQAPNEKVEDYVLELRKLAAKCNFKDMEDQVKEKLMDGVFSKMIKFELMKSASDATLERCIELARTVEAAILQANGATNEVSEIFVYKSTNKTPQQQRNTYQQKNQCYCCGKWNHLKRDCRLNRKYCSECGIQGHIFRMCPKKQRKVNVLQEDNQQKDKNTDNEPTEFEPKYYETYACNTVSKIPP

Summary

Pfam
PF00078   RVT_1        + More
PF17917   RT_RNaseH
PF00665   rve
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00098   zf-CCHC
PF00077   RVP
PF00378   ECH_1
PF03732   Retrotrans_gag
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
SSF52096   SSF52096       
Gene 3D
PDB
5O2U     E-value=0.00106175,     Score=99

Ontologies

Topology

Length:
368
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03050
outside
1  -  368
 
 

Population Genetic Test Statistics

Pi
323.112395
Theta
207.450206
Tajima's D
1.765536
CLR
0.182241
CSRT
0.84070796460177
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号