SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04562
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.386 Nuclear   Reliability : 1.459 PlasmaMembrane   Reliability : 1.323
 

Sequence

CDS
ATGCCGACAAACCCTGCGACTAGTACTGGTTTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGAGAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTGGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTAGTTGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGATCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAAATACTACAGGGCGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCACAAAACACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGTCTCTTCTGTCAATACTATGTTCGACACGCGATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTTGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTTAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCTGATGAGGAGAAATTAGACTCTTTTATTAGGGAACAATACAAAATTGATTCATTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGCTTATTAGCTCCAATAGTTGTTAAGGGTCGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTACACGTTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTATACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAGGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGACGCGCGCTCTTTTAAGCCTTTTGTTGCCCATCGTTTAGGCGAAATTATTGAAAACTCTTGCGTCAGAGACTGGCGATGGGTACCAACGGAATTGAATGTTGCCGACGACGCTACCAGAATGCGATCAATTAACCTCGACATGTCCCACAGATGGTTTCGCGGTCCATCTTTTCTTTTTAAATCCGTTGAGGACTGGCCTACAGAGCCAAGGTTTGCCTCACCAAACACCGATGAACTTAAGACCAATAGTTATGAGTTGGTCGGACTAACTTCCTTTGTCGAAGAGTTACCGACTCCGGTCACAGCCATTTTTGCTAATTTTAGTAATTGGCAGCGCTTATTACGTGCCACAGCCCGGGTACTTCAAGCTGCGGCAAAGTTTGGTGTAATTTTGGCTTCCATTAGAAATTCTAAATTGAAAGGCGAAATAGTTTGTGCCCGCCATCCTTCAACGTCCATTACTCTACCACCTCTTAGTGCGGATTTAATAAAGGCCGCTGAAAGGCAAATTATGCAACGAACACAGGTCGAGAGCTTTTCTATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCGGCTTTGGGAGAGGACAAATTACTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTCCCCATCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGGCTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAGTCCTTGCCGGTGAACCCGAAAACAGGAGATCTGTCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTGACTATCGGGCGCAGGCATGAAAAACGTTATGTGGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTACGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCTGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTCTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTTAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGGTTAGGCTCTCCACCTAA
Protein
MPTNPATSTGLQVNIIQPSTSQHVESIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRDLEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNQIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQNTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPQNTHLNKPYKRENIHIVTHSKLNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPVSSVNTMFDTRSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLLISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGLLAPIVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQRELHVFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNDARSFKPFVAHRLGEIIENSCVRDWRWVPTELNVADDATRMRSINLDMSHRWFRGPSFLFKSVEDWPTEPRFASPNTDELKTNSYELVGLTSFVEELPTPVTAIFANFSNWQRLLRATARVLQAAAKFGVILASIRNSKLKGEIVCARHPSTSITLPPLSADLIKAAERQIMQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLSPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLVRLST

Summary

Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF18701   DUF5641
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
1739
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03386
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1739
 
 

Population Genetic Test Statistics

Pi
406.332912
Theta
193.845643
Tajima's D
2.745765
CLR
0.062771
CSRT
0.96305184740763
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号