SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04558
Pre Gene Modal
BGIBMGA007097
Annotation
PREDICTED:_uncharacterized_protein_LOC105841862_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.161
 

Sequence

CDS
ATGAGCAGCGTACCGCCACAATTCATCATGCAGATGATGCATGTGATGCAGCAAATGTCGGAACGCCTAAGTACACCAGCAGAAACTAAGATACGTATAAATGATATTTACCTACCATCATTTGACCCCGATACTAGTGTGGGAGTTCGTGAGTGGTGTCAACATATCGACAAAGCCATTGAGACTTATCGACTCAACGACTTTGACATACGCATGAAAGTTGGCAGCCTCCTAAAGGGAAGAGCGAAGATGTGGGTTGACGATTGGATGGTCACTGCAGCTTCGTGGGCTGAGCTGCGCAACAATCTTATCACGACATTCGAGCCAGAAAATCGCTTTTCTCGAGACATAGCTCGATTTAGAGAACATATGTACGACTCTTCAAAGGACATCTCGGAGTTCTTGTCACGAGCTTGGGTCTTGTGGAGGAGGATCACCAAAGACAAACTACCTAATGAAGATGCAGTTGAAGCAGTTATTGGTTGCGTGAATGACGAGAAACTTAGGATCGAGCTACTAAACACAAGAGCCACAACAGTACCAGAATTGATATCTGTTGCATCATCAGTAAGAGCCATGAAGCGTTTTCACCAGGGCTCAAATAAGCTGAGTACAAATAAGCGTCCCCGTTTTTTGAATTCTACTTCATCAAATTCATCTTGCCATATCTGTAAAAGAACTAATCACACCACCAACGAATGCTACTACAAAATGGTTACCGAATTAAAGCCCGAACAAAGAAACAAAACAACAACTGAGACAACGAAGGAAGTAACCTCCTACCAGAACAATAAAACAACAATCTGTTCATTCTGCAAAATACCAGGACACAGTTTTGAAACATGCTTCAAACGTGAACGAGCATTGACATCAAACGTAAATTACGTTGCTGGATCAAAACTAGCTCCGATTCAGGTGAAGTTTGGATCAAAGAGTTTTCAGGCAATCTTTGATAGTGGCGCAGAATGCTCACTTATGCGGGAATCCGTAGCAGCTCAAATACCCGGAAAAAGACTACAAACGGCAGATTACTTGAAAGGAATTGGACAATTTCCTGTACTATCAATAGCTACACTCGTAACGGTAGGTGTCATCGATAACATCAACGTTGAATTACAGTTTCACATAGTGGCAGATTACGAGATGACTACAGATATTTTAGTGGGTATGAACTTGATAAACAATACGAACCTAACTATGACGATCACTTCGGGCGGAACGAGGCTAGCACGTCAGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATCAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCAATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTGTACGCGAAAGCAAGTCTCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGGGGCTAAATGGGAGTGGGACGAGCGCCATGAGAAAGCAAGAGAGAATGTCATTCAGTGCTTAACATCAACTCCAGTACTTACACTATTCCAGGAGGAAGCACCTATTCAATTGTACACAGATGCAAGTAGTTTGGGATTCGGAGCAGTACTGGGTCAACAGCTTCAACACGCAGACTACTTCAGTAGGAACCCAGTCGAACTCACAGTGAATATAATGACCAGAGATCTAGACTGGCTGAAAATTGAACAGCGACGTGATGAAACACTACGAGCTATAATGGATGGTATGAATAATAACAATCCAAGTAACGGCTATATGCTAGAAAACAATGTCCTCAAGCATATCGTACAAGATCCAACCTTCGGACACCGATACTGCACAGTGGTACCCAGATCCTTTCAGTGGAGTTTAATAAACTCCTTCCACACTGCACTGAAGCACCCTGGCTGGGAAAAGACGTTGCAGAAAATTAAGGACAGCCACTGGTTTGACAACATGAGCACGAAGGTACGAAAATTTGTTGATAATTGCGTGGTCTGCAGGACATCGAAAGGAGCATCTGGTGCGGTACAAGCTCAAATGCACCCGATTCAGAAACCGTCTGCTGCTTTTCAAGTAATACACATGGATATAACAGGCAAGATGGGAACATCCAACGACCAACAGTATGTGATTATCACCATAGATGCCTTTACGAAATACGTGCTATTCTATTATGCAACTAACAAAAATCCACCCAGCACATTAGCTGCCTTAAAGCGTACGGTTCATCTATTCGGTACTCCTGTCCAAATAATAGTCGACGGTGGAAGAGAGTTCCTCGGTGAATTCAAGACCTACTGCGATAGGGTAGGTATTGACATTCATGCTATAGCACCAGGAGTCAGCCGAGCAAATGGACAAGTAGAACGCGTCGTAGCTACACTAAAAAATACTCTTACTATGATCAAGAATTACGAAACAGAAGAGTGGCACACAACGATTGCAGAACTTCAGCTAGCAATAAATTGCACTCCGCATCGTGTGACAGGCGTAGCTCCACTTACATTACTCACTCAGCGAAAGCATTGTGTTCCTCCAGAGCTACTTAAATTAGTAAATATTGACGAGCAGACTATTGATATTGAAGCACTCACTAACCATGTTCAACACAAGATGTCACAAAATGCAGAACAGGACAGGCAACGTTTCAATTCAAAAAAAGCTAGGATCCATCCTTTCCAACGTGGTGATTATGTGCTCATAAAAAATAATCCTCGTAATCAAACTTCGTTGGATCTCAAATTCAGCGAGCCATATGAGATAACAAGAATCCTGGACAACGACCGCTATTTAGTAAAAAAGGTGGTTGGTTCAGGGCGTTCAAGAAAAGTAGCTCATCATCAACTCCGTCGGGCACCGCAACCTGGAGACCAGATAGCCGTATCGGCGGAAGAAGACGACCCTCCAGCATCAGCCGATGAACCTATATGA
Protein
MSSVPPQFIMQMMHVMQQMSERLSTPAETKIRINDIYLPSFDPDTSVGVREWCQHIDKAIETYRLNDFDIRMKVGSLLKGRAKMWVDDWMVTAASWAELRNNLITTFEPENRFSRDIARFREHMYDSSKDISEFLSRAWVLWRRITKDKLPNEDAVEAVIGCVNDEKLRIELLNTRATTVPELISVASSVRAMKRFHQGSNKLSTNKRPRFLNSTSSNSSCHICKRTNHTTNECYYKMVTELKPEQRNKTTTETTKEVTSYQNNKTTICSFCKIPGHSFETCFKRERALTSNVNYVAGSKLAPIQVKFGSKSFQAIFDSGAECSLMRESVAAQIPGKRLQTADYLKGIGQFPVLSIATLVTVGVIDNINVELQFHIVADYEMTTDILVGMNLINNTNLTMTITSGGTRLARQPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIVRESKSPYSSPIILVKKKNGAKWEWDERHEKARENVIQCLTSTPVLTLFQEEAPIQLYTDASSLGFGAVLGQQLQHADYFSRNPVELTVNIMTRDLDWLKIEQRRDETLRAIMDGMNNNNPSNGYMLENNVLKHIVQDPTFGHRYCTVVPRSFQWSLINSFHTALKHPGWEKTLQKIKDSHWFDNMSTKVRKFVDNCVVCRTSKGASGAVQAQMHPIQKPSAAFQVIHMDITGKMGTSNDQQYVIITIDAFTKYVLFYYATNKNPPSTLAALKRTVHLFGTPVQIIVDGGREFLGEFKTYCDRVGIDIHAIAPGVSRANGQVERVVATLKNTLTMIKNYETEEWHTTIAELQLAINCTPHRVTGVAPLTLLTQRKHCVPPELLKLVNIDEQTIDIEALTNHVQHKMSQNAEQDRQRFNSKKARIHPFQRGDYVLIKNNPRNQTSLDLKFSEPYEITRILDNDRYLVKKVVGSGRSRKVAHHQLRRAPQPGDQIAVSAEEDDPPASADEPI

Summary

Pfam
PF00078   RVT_1        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
3S3N     E-value=4.68487e-12,     Score=176

Ontologies

Topology

Length:
1014
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03079
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00049
outside
1  -  1014
 
 

Population Genetic Test Statistics

Pi
251.521985
Theta
192.18015
Tajima's D
2.85722
CLR
23.265876
CSRT
0.971701414929254
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号