SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04525
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.688 Nuclear   Reliability : 2.151
 

Sequence

CDS
ATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGAACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGTGCGGCAAACTAGATCCATAG
Protein
MPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHANPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMCGKLDP

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    KQ459580    KPI99178.1    AF081103    AAC72921.1    AF081101    AAC72919.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005300    JAB63166.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01019198    MBY31817.1    ABLF02003961    ABLF02059872    GGMS01004685    MBY73888.1    ABLF02008933    KK113014    KFM59099.1    ABLF02042518    ABLF02057746    KK117880    KFM71667.1    GFTR01008038    JAW08388.1    NEVH01012084    PNF30905.1    ABLF02036077    ABLF02036081    NEVH01003017    PNF40781.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01020071    PNF21969.1    ABLF02019349    ABLF02041900    NEVH01005938    PNF38077.1    NEVH01010546    PNF32261.1    NEVH01000598    PNF43535.1    NEVH01001355    PNF42855.1    GGMR01003407    MBY16026.1    NEVH01000280    PNF43672.1    NEVH01023961    PNF17613.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01014858    PNF27387.1    NEVH01007838    PNF34986.1    NEVH01002716    PNF41415.1    NEVH01011985    PNF31054.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    GGMR01016114    MBY28733.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01026154    PNF14491.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01017559    PNF23833.1    GGMS01000737    MBY69940.1    JRES01000644    KNC29657.1    NEVH01016327    PNF25684.1    NEVH01021205    PNF19912.1    GEZM01038405    JAV81653.1    GBBI01004395    JAC14317.1    ABLF02041993    LBMM01014395    KMQ85192.1    ABLF02033757    NEVH01019080    PNF22876.1    NEVH01006721    PNF37225.1    GGMS01008766    MBY77969.1    GGMR01000676    MBY13295.1    ABLF02066620    DNOY01000259    HBE18313.1    NEVH01026386    PNF14434.1    GEZM01053022    JAV74219.1    GFXV01000774    MBW12579.1    GGMS01012005    MBY81208.1    NEVH01020963    PNF20308.1    GGMR01018716    MBY31335.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    NWSH01000032    PCG80497.1    GGMR01004661    MBY17280.1    GBGD01000415    JAC88474.1    GBBI01001646    JAC17066.1    GGMS01002992    MBY72195.1    GFXV01006424    MBW18229.1    GGFJ01001858    MBW50999.1    ABLF02008463    GBGD01000880    JAC88009.1    GBGD01000799    JAC88090.1    NEVH01007393    PNF35987.1    GBBI01001693    JAC17019.1    GGMS01017914    MBY87117.1    NEVH01012089    PNF30491.1    GGFJ01001857    MBW50998.1    NEVH01007578    PNF35646.1    LBMM01013518    KMQ85605.1    ABLF02055645    KK113137    KFM59425.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00383202,     Score=96

Ontologies

Topology

Length:
483
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02817
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00079
outside
1  -  483
 
 

Population Genetic Test Statistics

Pi
17.96591
Theta
24.454371
Tajima's D
-1.102498
CLR
20.004444
CSRT
0.11704414779261
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号