SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04490
Annotation
non-LTR_retrotransposon_R1Bmks_ORF2_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.464
 

Sequence

CDS
ATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGTGCGTTGTGGAGGGGACCTTCCCGCCGGTGTGGAAGGATGGCCGCCTACTTGTTCTGCCAAAGGGGAATGGCAGGCCCTTAACGGACCCCAAGGCGTATCGCCCGGTCACCTTGCTGCCGGTCCTGGGAAAGATCTTGGAGAAGGTACTATTGCAGTGTGCTCCTGGCCTCACCCAAAGTATTAGTCCGCGCCAGCACGGGTTCTCTCCTGGACGCTCAACGGTGACGGCGCTGCGAACTCTGCTGGACGTGTCGCGCGCCTCGGAGCAGAGGTACGTAATGGCCATATTCTTGGACATCAGTGGAGCTTTCGATAACGCGTGGTGGCCCATGATAATGGTGAAGGCCAAGCGGAACTGTCCGCCCAACATCTATCGGATGCTGACGGACTATTTCCGCGGACGCCGTATTGCCGTTGTCGCGGGGGAATGTGCGGAGTGGAAGGTGTCCACGATGGGCTGTCCGCAGGGCTCAGTGCTCGGGCCGACGCTCTGGAACGTTCTGATTGATGACCTGCTCGCCTTGCCGCAGGGGGTAGAGGGAACAGAGATGGTCGCCTATGCCGATGACGTGACGGTACTGGTTAGGGGTGACTCACGGGCGCAGCTTGAGAGGAGAGCGCACGCCGTGCTAGGACTCGCAGAGGGGTGGGCGAGCAGGAATAAGCTCGATTTTGCCCCGGCGAAGTCCCGATGCATAATGTTGAGGGGGAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTAGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTACGCGGCGGCCGTATGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGGCGGATCGACAGCGATGTCTTGGTAGTTTGGCAGGACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGTGGACAGGAAGAAGGCAACGTGGATAGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGACATGGGATCTTCAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGACAGGGACCATGTCCTGTGGGAGTGTCCTCTATATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGCAAAACTTTCAGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARCVVEGTFPPVWKDGRLLVLPKGNGRPLTDPKAYRPVTLLPVLGKILEKVLLQCAPGLTQSISPRQHGFSPGRSTVTALRTLLDVSRASEQRYVMAIFLDISGAFDNAWWPMIMVKAKRNCPPNIYRMLTDYFRGRRIAVVAGECAEWKVSTMGCPQGSVLGPTLWNVLIDDLLALPQGVEGTEMVAYADDVTVLVRGDSRAQLERRAHAVLGLAEGWASRNKLDFAPAKSRCIMLRGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCLGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVCTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDSDVLVVWQDRWVSEGKGRELYKFFPDVVDRKKATWIEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEQNFQLLREFAHTWHTARTARESRGLPGDEECG

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=2.32056e-06,     Score=124

Ontologies

Topology

Length:
570
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.16526
Exp number, first 60 AAs:
0.00197
Total prob of N-in:
0.04969
outside
1  -  570
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号