SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04484
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.798
 

Sequence

CDS
ATGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGACGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCGCACGGATGCGCGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGGAATCCCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTTGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATAGTTTCCGCGCTTTTCCCGCCGGCAGAGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCTGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAGGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGTGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAGCTTCCGCGCTCACTTCGAAAAATTGGGCCCTCGGCTGATGGCGACGGCCGGCTCTCTGAGCCGGCTTCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCTCCCGTATGGTGCCACGCCCTGACCCGCGAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACATACATTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MEPRRVRAVSGRARDAFTPPRVPPCHRRGGLQCQVHGLGFPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGESHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDATFAETAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAEGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWSFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRENVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    AB078936    BAC06464.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    RSAL01003504    RVE40273.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01008422    KMQ88894.1    LBMM01007425    KMQ89740.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01004505    KMQ92346.1    LBMM01002480    KMQ94776.1    LBMM01014122    KMQ85315.1    LBMM01015018    KMQ84954.1    LBMM01015285    KMQ84870.1    LBMM01005948    KMQ91066.1    LBMM01008445    KMQ88871.1    LBMM01005474    KMQ91485.1    LBMM01004262    KMQ92649.1    LBMM01005733    KMQ91252.1    LBMM01003245    KMQ93755.1    LBMM01006977    KMQ90149.1    GGMR01015159    MBY27778.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02034925    ABLF02011238    GGMR01004600    MBY17219.1    ABLF02041886    ABLF02011183    ABLF02041884    LBMM01004261    KMQ92650.1    ABLF02018942    ABLF02041885    ABLF02018808    ABLF02013358    ABLF02013361    ABLF02054869    GAMC01020517    JAB86038.1    GFXV01003903    MBW15708.1    GAMC01020519    GAMC01020515    JAB86040.1    LBMM01008226    KMQ89040.1    LBMM01009535    KMQ88053.1    KU543683    AMS38371.1    KQ971309    EEZ99146.1    GAKP01002292    JAC56660.1    ABLF02041557    GGMR01012748    MBY25367.1    LBMM01009610    KMQ87992.1    ABLF02023257    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02007989    AJ278684    CAB99192.1    GALA01001777    JAA93075.1    GFXV01002090    MBW13895.1    ABLF02021100    KU543682    AMS38369.1    KQ972226    KYB24577.1    GGFK01005660    MBW38981.1    GAPW01000192    JAC13406.1    ABLF02014378    ABLF02011927    GGMR01011682    MBY24301.1    ABLF02059310    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GALA01001776    JAA93076.1    GEHC01000915    JAV46730.1    AB593326    BAK38647.1    GGMR01019493    MBY32112.1    GALA01000302    JAA94550.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000178471,     Score=110

Ontologies

Topology

Length:
985
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11181
Exp number, first 60 AAs:
0.00299
Total prob of N-in:
0.00038
outside
1  -  985
 
 

Population Genetic Test Statistics

Pi
1.18884
Theta
0.807813
Tajima's D
0
CLR
0.427879
CSRT
0.444977751112444
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号