SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04472
Pre Gene Modal
BGIBMGA010315
Annotation
Gag-like_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 1.986
 

Sequence

CDS
ATGGACCCTCGTGGTATAACACCGAACACTTCGAACCAACAGTTAGTTATAAACGGTGATAATGATTCGGCGACGGCACTTCTACAGGAGAAACAGGCGAGAAGACATAACAGTCTACGTGAAGTGACCTTCTCACAATATATGACTGTCTCTATATTATGCTTCGTTAACCTCATCAACTACATGGACAGATTGACTATCGCCGTGGGAGATGGGTCGGTGGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAGCGCAAAGCTGTCGCGGCTGACGAAGTGTCGGAAATGGCCCGACGCGCTCGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTAAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTTAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCTGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTACTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATTGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGCCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGGTCACGGTCGCATGTCTGCCAACATACAGCAAGAAAGATCTTGCATTGGACCATCTAAAATTGACCTATAAAAATCAATAA
Protein
MDPRGITPNTSNQQLVINGDNDSATALLQEKQARRHNSLREVTFSQYMTVSILCFVNLINYMDRLTIAVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSKLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRITGLDDSVTSEEVVAAVARSGECPLDKVRAGDIRTDATGLGVAWVRCPVASAKKIALSGRLLVTVACLPTYSKKDLALDHLKLTYKNQ

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
618
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.97549
Exp number, first 60 AAs:
2.78898
Total prob of N-in:
0.14816
outside
1  -  618
 
 

Population Genetic Test Statistics

Pi
165.968222
Theta
155.718203
Tajima's D
0.043517
CLR
0.98245
CSRT
0.383130843457827
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号