SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04460
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.373 Nuclear   Reliability : 1.556
 

Sequence

CDS
ATGGCGTATATAAGTAGAATAAAGCCCCTATCCGTAACGATAGGATTTTTTAACGCTTACGGTCTCGCAAATCAACGTGATCAGGTTTCTGACTTTTTGCGTGACCATCAAATTGACATCTTTTTGGTGCAGGAGACCCTGCTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCCTGCACTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACACCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCAGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGATTTCCTTCACCGCTTCAAATTGTCCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTGAAATCGGATACGGTAGCAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGTTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCTTCTTTATTCTTTATTTTTTGTACACACTGTTAATATAATACAGTAA
Protein
MAYISRIKPLSVTIGFFNAYGLANQRDQVSDFLRDHQIDIFLVQETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVATMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVLLYSLFFVHTVNIIQ

Summary

Subunit
The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
Similarity
Belongs to the histone H2A family.
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
AF081103    AAC72921.1    KQ459265    KPJ02064.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01012398    MBY81601.1    GGMR01012189    MBY24808.1    GGMR01004661    MBY17280.1    GBBI01004395    JAC14317.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02022418    KK118005    KFM71947.1    ABLF02012584    ABLF02013765    ABLF02024884    GEBQ01003077    JAT36900.1    ABLF02065839    KK115285    KFM64681.1    ABLF02023911    GGMS01010725    MBY79928.1    GGMR01016297    MBY28916.1    GGMR01018716    MBY31335.1    GEBQ01004157    JAT35820.1    GFTR01008279    JAW08147.1    GFTR01008262    JAW08164.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02009591    ABLF02009592    ABLF02009594    ABLF02066703    ABLF02003241    ABLF02003242    ABLF02025904    KK119692    KFM76444.1    GGMS01006359    MBY75562.1    KB632143    ERL89075.1    KK113281    KFM59799.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    ABLF02014934    ABLF02014939    ABLF02017810    LBMM01018021    KMQ83899.1    NEVH01011985    PNF31054.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GFTR01008260    JAW08166.1    JTDY01002082    KOB72150.1    JTDY01011738    KOB53653.1    NEVH01001347    PNF42966.1    NEVH01021205    PNF19912.1    NEVH01017470    PNF24199.1    GFTR01008271    JAW08155.1    NEVH01005277    PNF39135.1    GGMS01000479    MBY69682.1    ACPB03027378    NEVH01006736    PNF36716.1    NEVH01005923    PNF38085.1    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01000226    MBY12845.1    GECL01003538    JAP02586.1    GGMS01001094    MBY70297.1    ABLF02034467    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02037715    GGMR01015412    MBY28031.1    AJVK01033868    GGMS01002992    MBY72195.1    KK119923    KFM77079.1    GFTR01008261    JAW08165.1    GBGD01000415    JAC88474.1    GGFK01009732    MBW43053.1    M17214    AAA28508.1    ACPB03022356    GFTR01008257    JAW08169.1    ABLF02001804    ABLF02035179    ABLF02062794    GGMR01016905    MBY29524.1    GALX01005359    JAB63107.1    NEVH01016302    PNF25823.1    NWSH01007753    PCG62823.1    ABLF02042518    ABLF02057746    GGMS01014910    MBY84113.1    GFTR01008151    JAW08275.1    LBMM01015125    KMQ84919.1    JTDY01005246    KOB67202.1    JTDY01003188    KOB69997.1    ACPB03000870    ABLF02041767    GFTR01008254    JAW08172.1    GBHO01019476    GBHO01012642    GBHO01012640    JAG24128.1    JAG30962.1    JAG30964.1    NEVH01023280    PNF18085.1    ABLF02066437   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF14291   DUF4371
PF05699   Dimer_Tnp_hAT
PF03372   Exo_endo_phos
PF16211   Histone_H2A_C
PF00125   Histone
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR025398   DUF4371       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR006580   Znf_TTF       
IPR020847   AP_endonuclease_F1_BS       
IPR032458   Histone_H2A_CS       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF47113   SSF47113       
Gene 3D

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
Length:
437
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.16075
Exp number, first 60 AAs:
0.12339
Total prob of N-in:
0.01193
outside
1  -  437
 
 

Population Genetic Test Statistics

Pi
2.557035
Theta
3.647549
Tajima's D
-0.97626
CLR
852.011488
CSRT
0.138693065346733
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号