SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04449
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.235 PlasmaMembrane   Reliability : 1.116
 

Sequence

CDS
ATGGCCGAGTTTAGGATCACCGGCCTGGACGACTGCGCCACTAAGGAGGAGATGGCAGCTGCGATAGCGGCCCAGGGGAGATGTGCCGCAGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGGTCAGCGTGGGTGCGCTGCCCTGTGGAGGCGGCCACTTCCTTGGCCACTCCTCCACCGGGTAGATCGACGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGGTGCTTCAGCACGGGGCACGGACTCGCTAGGTGCACCAGCTCGGTTGACCGCAGCGGTTTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCTAAGTCCTGCACGGCCACCCCGCATTGCGCTCTGTGCGCTGCAGCCGGACGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAATAATACCGAACGCAACCGGCGCCGAAAATCGAAGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCTGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTATTTCGTTCCCCCAGCAAATGATTGTTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATACGAAGAGACGCGGCGATCCCCCCCCTGGCGAAGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGAGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTATCGCATGGGGCTCCCCTCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGTTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCTCGGGGACCACCCCCGTGAGGCCCGGCTGCACGCCGCATTTCGCGTCGCACAGAGGGCACTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACTCGCCGCCGGAATACGACGGCGAAGTCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGAACGGGCAGACTCGTGCGGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCTGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCAGGGTGGGGCCCGATCTGTCGGCGGAGCAATATGGCTTCCGAGAGGGCCGCGCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGATGAGGCCGTTTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACTCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTTCTACTTGGAGGACAGATCGGTTACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAAGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAACGTTGGGGGCCTGACCAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCACCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MAEFRITGLDDCATKEEMAAAIAAQGRCAAESVTVGELRSGYSGARSAWVRCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAKSCTATPHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRKSKRRQKRRLARGALANAVIPAAALVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAKVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGEIGAIARRLAPRPVILAGDLNAKSIAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADALGDHPREARLHAAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDSPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVRLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRATVDAILRVRALSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGFYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIKRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGLTRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWHRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF13359   DDE_Tnp_4
PF12017   Tnp_P_element
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=6.6724e-12,     Score=175

Ontologies

Topology

Length:
1002
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.02953
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04448
outside
1  -  1002
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.022577
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号