SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO04447
Pre Gene Modal
BGIBMGA005419
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.046
 

Sequence

CDS
ATGATGAATTTTTTTAGTAAAGCTCCAACCGTGAAGGAAATTCAAAGGCAAAATGACCGTGATCTACGAAAGGCTGGTCGCGACCTGGAAAGAGATAAAGCTAACCTGGAAAGGGAAGAAAAGAAATTAGTAAAGTGGTGTTTCGCTGCAGAAAATTTTTTAGTACTCGAAGGCATGAAGCATTGCATCAAGCCAGAACCGGGGAAAGAAATAGCAAGCGCGGATGACGAAAAAACTAAAGCCAAATTGATCATGACCATCGACCCGTCGTTGTACTGTCCGAGTTTAGAAGCCGAAAAAAGAAAACAATCCAACGCCTTTAGTGCTATTTTCTTAAGTGGAAATTTCAACTGCGATAGTTGGTACATAGATAGCGGGGCCAGCAAACACATGACAGCAAAGAAAGAATACGTTGAGAGTCCATCATTTGAACATGAAATTAAAGAAATAATTGTTGCGAACAAAACATCCGTCCCGGTAGTGTGTTCTGGTGATGTAAACATAATCACAGTTGTGAATGGTGTAGAATATGACATCACAGTTTCAAATGTATTGTGCATACCGAGTTTAACAACAAACTTGCTTTCAGTGAGTCAGTTAATTGAGAATGGCAATAAGGTAATCTTTAAAGAGAAATTTTGCTATATTTACAATCAACAGAGAACTCTAGTTGGAAAGGCAGAATTAGTAGATGGTGTGTACAGATTATATACTAAGAAATCAGAACAGTTATTCGCAGCCACAGCTAAGGTGTCGAGTGAAACTTGGCACCGACGATTAGGGCATATCAACAGTACCAGCTTGAACAAAATGAAGAATGGAGCTACGACAGGTATTTCATACACAAATAAAGCTGATGTTGACAAATCTAAGTGTACTGTTTGCTGTAAGGGGAAGCAGTCTAGACTACCTTTTCAGCCTAGTTCAACTAACACCCAAGATATTTTAGAATTAATACACTCAGATGTGTGTGGTCCGATGGAAAATGTGTCCATTGGAGGATCCAGATACTATGTCTTATTTGTGGATGACTACAGCAGAATGGTTTTTGTATACTTCATGAAAACAAAGTCAGAGGTATTTAAGTTTTTCAAAGAATTCCAGTCACTTGTAGAAAAACAGACAGATCGGAAAATTAAAATTCTAAGAACAGACAATGGCGGTGAGTACTGCAGTCAAGACTTTGAAAGATATCTAAAACAACACGGAATAATTCACCAGAAAAGTAATGCTTACACACCACAGCAAAATGGTGTGTGTGAAAGGATGAATAGGTCACTAGTTGAAAAGGCTAGATGTCTAATTTTTGATGCTGGTTTACATAAAAAGTTTTGGGCAGAAGCCATAAATACATCTGTATACTTAAGGAATCGATCAGTTGTTACTGGATTAAACAACATGACTCCATATGAAGCCTGGACAAAGAAAAAACCTGACTTAAGTCATGTACGTATTTTTGGAAGTAAGGTTATGATGCACATACCAAAAGAAAAGCGCTTAAAATGGGATATGAAGGCTAAAGAACTTATTTTGGTAGGCTATGCAGACAATGTAAAAGGCTATAGGGTTTATAACCCAGAAAATAACTCTGTCACAACTAGCAGAGACATTATAATAATGGAGAAAACTGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAGGAAGTGACTCATATGACAGTTTTTCTGAAACACCATCAGAACCAGAACCTTCATTATTAGAATTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAAGTATGAACCGTGTTTGTTTACGAAGTCTGAAGGAAATGCTAAAGTTATAATAGCATTGTTTGTTGATGATTTTTTTGTTTTTTCTAACTGTAAAATGGCAACTAATCAGTTAATACAAGATTTGAGTAGTAAATTTAAAATTAAAGATTTGGGTCAAATAAAGCAATGTTTAGGCTTAAGAGTGAATATGTATAAAAATGCTATAACTGTTGATCAAGAACAGTATATAGAAAGCTTGTTAAAAAAGTTTAACATGTCACATTGTAAAACTATAGAAACTCCTATGGAGATTAACTTAAGATTGGAAAAATCTGAGAATAGTTTATGTAATAAAAATATTCCATATAGACAATTAATAGGTAACTTAATGTATTTAGCTGTGTTAACCAGACCAGACATAGCTTACAGTGAAATGGAAATAAAGAAAATGGCTAAAGAAGGTAACAATGATGGTTGCAAAATATTAGCCAAACAATTAGTTCAATTAAGAAAACAGAAAAACAGAATTTATGCTGCAAATAGCAAGATATCAAGTGTACAGATCCACAATAAAGCAATGGGTGCAAATATTGCTATTGCAGGAGCAATGGGCACTACAGCTAAAACAATGGGCAACATGAATAAGGTTATGAATCCACATCAAATTGCAAAGGATATGGAGGCATTCAAACAGGCAAATGCCAAAATGGATATGACAGATGAAATGATTTCAGACACACTAGATGATATCATGGACGAATCTGGTGATGAGGAAGAATCTGCTGGAATTGTCAACCAGGTGCTGGATGAGATCGGTATAGAAATCAGCGGGAAGATGGCAGACGCTCCTTCAGTTTCCCGGAACAAAATCGGACAATCAACTACAGACGCCGACAAAGATATAATGGCACAACTCGCTAAACTGAAATCCACATAG
Protein
MMNFFSKAPTVKEIQRQNDRDLRKAGRDLERDKANLEREEKKLVKWCFAAENFLVLEGMKHCIKPEPGKEIASADDEKTKAKLIMTIDPSLYCPSLEAEKRKQSNAFSAIFLSGNFNCDSWYIDSGASKHMTAKKEYVESPSFEHEIKEIIVANKTSVPVVCSGDVNIITVVNGVEYDITVSNVLCIPSLTTNLLSVSQLIENGNKVIFKEKFCYIYNQQRTLVGKAELVDGVYRLYTKKSEQLFAATAKVSSETWHRRLGHINSTSLNKMKNGATTGISYTNKADVDKSKCTVCCKGKQSRLPFQPSSTNTQDILELIHSDVCGPMENVSIGGSRYYVLFVDDYSRMVFVYFMKTKSEVFKFFKEFQSLVEKQTDRKIKILRTDNGGEYCSQDFERYLKQHGIIHQKSNAYTPQQNGVCERMNRSLVEKARCLIFDAGLHKKFWAEAINTSVYLRNRSVVTGLNNMTPYEAWTKKKPDLSHVRIFGSKVMMHIPKEKRLKWDMKAKELILVGYADNVKGYRVYNPENNSVTTSRDIIIMEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSGSDSYDSFSETPSEPEPSLLELNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSKYEPCLFTKSEGNAKVIIALFVDDFFVFSNCKMATNQLIQDLSSKFKIKDLGQIKQCLGLRVNMYKNAITVDQEQYIESLLKKFNMSHCKTIETPMEINLRLEKSENSLCNKNIPYRQLIGNLMYLAVLTRPDIAYSEMEIKKMAKEGNNDGCKILAKQLVQLRKQKNRIYAANSKISSVQIHNKAMGANIAIAGAMGTTAKTMGNMNKVMNPHQIAKDMEAFKQANAKMDMTDEMISDTLDDIMDESGDEEESAGIVNQVLDEIGIEISGKMADAPSVSRNKIGQSTTDADKDIMAQLAKLKST

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF13961   DUF4219
PF07727   RVT_2
PF00665   rve
PF00098   zf-CCHC
PF05380   Peptidase_A17
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR039537   Retrotran_Ty1/copia-like        + More
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR036397   RNaseH_sf       
IPR009056   Cyt_c-like_dom       
IPR008042   Retrotrans_Pao       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D
PDB
3FRT     E-value=0.000135288,     Score=112

Ontologies

Topology

Length:
1124
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04557
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00037
outside
1  -  1124
 
 

Population Genetic Test Statistics

Pi
431.268556
Theta
197.344269
Tajima's D
2.740929
CLR
0.000392
CSRT
0.96285185740713
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号